TSC22D1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51196-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TSC22D1 Reagents
CRO Services
Product recommended

All TSC22D1 Reagents
TSC22D1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
432 bp
Description
Full length Clone DNA of Mouse TSC22 domain family, member 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TSC22D1 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AA589566 cDNA ORF Clone, Mouse;AW105905 cDNA ORF Clone, Mouse;Egr5 cDNA ORF Clone, Mouse;Tgfb1i4 cDNA ORF Clone, Mouse;Tsc cDNA ORF Clone, Mouse;TSC-22 cDNA ORF Clone, Mouse;Tsc22 cDNA ORF Clone, Mouse
TSC22D1 Background Information

TSC22 domain family, member 1 (TSC22D1) is one of the TGF-beta-stimulated clone-22 (TSC-22). TSC-22 was reported to be a differentiation-inducing factor which negatively regulates the growth of salivary gland cancer cells. TSC22D1, which encodes transforming growth factor beta-stimulated clone 22 (TSC-22), is thought to be a tumor suppressor because its expression is lost in many glioblastoma, salivary gland, and prostate cancers. TSC-22 is the founding member of the TSC-22/DIP/Bun family of leucine zipper transcription factors. TSC-22 may play an important role in maintaining the differentiated phenotype in salivary gland tumors, and may be a possible target of leukemia therapy. TSC22D1 forms homodimers via its conserved leucine zipper domain and heterodimerizes with TSC22D4. TSC22D1 has transcriptional repressor activity.

Full Name
TSC22 domain family, member 1
References
  • Doi Y, et al. (2008) Expression and cellular localization of TSC-22 in normal salivary glands and salivary gland tumors: implications for tumor cell differentiation. Oncol Rep. 19(3): 609-16.
  • Wu X, et al. (2008) The Drosophila homolog of human tumor suppressor TSC-22 promotes cellular growth, proliferation, and survival. Proc Natl Acad Sci U S A. 105(14): 5414-9.
  • Lu Y, et al. (2007) Identification of TSC-22 as a potential tumor suppressor that is upregulated by Flt3-D835V but not Flt3-ITD. Leukemia. 21(11): 2246-57.
  • TSC22D1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TSC22D1 cDNA ORF Clone in Cloning Vector, Rat RG81159-U
    TSC22D1 cDNA ORF Clone, Rat, untagged RG81159-UT
    TSC22D1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81159-ACG
    TSC22D1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81159-ACGLN
    TSC22D1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81159-ANG
    TSC22D1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81159-ACR
    TSC22D1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81159-ANR
    TSC22D1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81159-CF
    TSC22D1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81159-NF
    TSC22D1 cDNA ORF Clone, Rat, C-His tag RG81159-CH
    TSC22D1 cDNA ORF Clone, Rat, N-His tag RG81159-NH
    TSC22D1 cDNA ORF Clone, Rat, C-HA tag RG81159-CY
    TSC22D1 cDNA ORF Clone, Rat, N-HA tag RG81159-NY
    TSC22D1 cDNA ORF Clone, Rat, C-Myc tag RG81159-CM
    TSC22D1 cDNA ORF Clone, Rat, N-Myc tag RG81159-NM
    TSC22D1 qPCR Primer Pairs, Rat RP301115

    TSC22D1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TSC22D1 cDNA ORF Clone in Cloning Vector, Mouse MG51196-U
    TSC22D1 cDNA ORF Clone, Mouse, untagged MG51196-UT
    TSC22D1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51196-ACGLN
    TSC22D1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51196-ACG
    TSC22D1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51196-ANG
    TSC22D1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51196-ACR
    TSC22D1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51196-ANR
    TSC22D1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51196-CF
    TSC22D1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51196-NF
    TSC22D1 cDNA ORF Clone, Mouse, C-His tag MG51196-CH
    TSC22D1 cDNA ORF Clone, Mouse, N-His tag MG51196-NH
    TSC22D1 cDNA ORF Clone, Mouse, N-HA tag MG51196-NY
    TSC22D1 cDNA ORF Clone, Mouse, C-Myc tag MG51196-CM
    TSC22D1 cDNA ORF Clone, Mouse, N-Myc tag MG51196-NM
    TSC22D1 qPCR Primer Pairs, Mouse MP201080

    TSC22D1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TSC22D1 cDNA ORF Clone in Cloning Vector, Human HG16577-G
    TSC22D1 cDNA ORF Clone, Human, untagged HG16577-UT
    TSC22D1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16577-ACG
    TSC22D1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16577-ACGLN
    TSC22D1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16577-ANG
    TSC22D1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16577-ACR
    TSC22D1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16577-ANR
    TSC22D1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16577-CF
    TSC22D1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16577-NF
    TSC22D1 cDNA ORF Clone, Human, C-His tag HG16577-CH
    TSC22D1 cDNA ORF Clone, Human, N-His tag HG16577-NH
    TSC22D1 cDNA ORF Clone, Human, C-HA tag HG16577-CY
    TSC22D1 cDNA ORF Clone, Human, N-HA tag HG16577-NY
    TSC22D1 cDNA ORF Clone, Human, C-Myc tag HG16577-CM
    TSC22D1 cDNA ORF Clone, Human, N-Myc tag HG16577-NM
    info info
    添加购物车成功! 添加购物车失败!