TMEM98 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52042-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TMEM98 Reagents
CRO Services
Product recommended

All TMEM98 Reagents
TMEM98 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Mouse transmembrane protein 98 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM98 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
6530411B15Rik cDNA ORF Clone, Mouse;AI463522 cDNA ORF Clone, Mouse
TMEM98 Background Information
Full Name
transmembrane protein 98

TMEM98 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM98 cDNA ORF Clone in Cloning Vector, Mouse MG52042-U
TMEM98 cDNA ORF Clone, Mouse, untagged MG52042-UT
TMEM98 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52042-ACGLN
TMEM98 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52042-ACG
TMEM98 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52042-ANG
TMEM98 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52042-ACR
TMEM98 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52042-ANR
TMEM98 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52042-CF
TMEM98 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52042-NF
TMEM98 cDNA ORF Clone, Mouse, C-His tag MG52042-CH
TMEM98 cDNA ORF Clone, Mouse, N-His tag MG52042-NH
TMEM98 cDNA ORF Clone, Mouse, C-HA tag MG52042-CY
TMEM98 cDNA ORF Clone, Mouse, C-Myc tag MG52042-CM
TMEM98 cDNA ORF Clone, Mouse, N-Myc tag MG52042-NM
TMEM98 qPCR Primer Pairs, Mouse MP201915

TMEM98 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM98 cDNA ORF Clone in Cloning Vector, Human HG26720-U
TMEM98 cDNA ORF Clone, Human, untagged HG26720-UT
TMEM98 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG26720-ACGLN
TMEM98 cDNA ORF Clone, Human, C-GFPSpark® tag HG26720-ACG
TMEM98 cDNA ORF Clone, Human, N-GFPSpark® tag HG26720-ANG
TMEM98 cDNA ORF Clone, Human, C-OFPSpark® tag HG26720-ACR
TMEM98 cDNA ORF Clone, Human, N-OFPSpark® tag HG26720-ANR
TMEM98 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG26720-CF
TMEM98 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG26720-NF
TMEM98 cDNA ORF Clone, Human, C-His tag HG26720-CH
TMEM98 cDNA ORF Clone, Human, N-His tag HG26720-NH
TMEM98 cDNA ORF Clone, Human, C-HA tag HG26720-CY
TMEM98 cDNA ORF Clone, Human, N-HA tag HG26720-NY
TMEM98 cDNA ORF Clone, Human, C-Myc tag HG26720-CM
TMEM98 cDNA ORF Clone, Human, N-Myc tag HG26720-NM
info info
添加购物车成功! 添加购物车失败!