Transferrin Receptor cDNA ORF Clone, Mouse, N-His tag

Cat: MG50741-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Transferrin Receptor Reagents
CRO Services
Product recommended

All Transferrin Receptor Reagents
Transferrin Receptor cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2292 bp
Description
Full length Clone DNA of Mouse transferrin receptor with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Transferrin Receptor cDNA ORF Clone, Mouse, N-His tag Alternative Names
2610028K12Rik cDNA ORF Clone, Mouse;AI195355 cDNA ORF Clone, Mouse;AI426448 cDNA ORF Clone, Mouse;AU015758 cDNA ORF Clone, Mouse;CD71 cDNA ORF Clone, Mouse;E430033M20Rik cDNA ORF Clone, Mouse;Mtvr-1 cDNA ORF Clone, Mouse;Mtvr1 cDNA ORF Clone, Mouse;p90 cDNA ORF Clone, Mouse;TFR cDNA ORF Clone, Mouse;TFR1 cDNA ORF Clone, Mouse;TR cDNA ORF Clone, Mouse;Trfr cDNA ORF Clone, Mouse
Transferrin Receptor Background Information

Transferrin receptor protein 1, also known as transferrin receptor, Trfr, p90, CD71 and TFRC, is a single-pass type II membrane protein which belongs to the peptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.

Full Name
transferrin receptor
References
  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.
  • Transferrin Receptor cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Transferrin Receptor cDNA ORF Clone in Cloning Vector, Rhesus CG90253-G
    Transferrin Receptor cDNA ORF Clone, Rhesus, untagged CG90253-UT
    Transferrin Receptor cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90253-ACG
    Transferrin Receptor Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90253-ACGLN
    Transferrin Receptor cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90253-ACR
    Transferrin Receptor cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90253-CF
    Transferrin Receptor cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90253-NF
    Transferrin Receptor cDNA ORF Clone, Rhesus, C-His tag CG90253-CH
    Transferrin Receptor cDNA ORF Clone, Rhesus, N-His tag CG90253-NH
    Transferrin Receptor cDNA ORF Clone, Rhesus, C-HA tag CG90253-CY
    Transferrin Receptor cDNA ORF Clone, Rhesus, N-HA tag CG90253-NY
    Transferrin Receptor cDNA ORF Clone, Rhesus, C-Myc tag CG90253-CM
    Transferrin Receptor cDNA ORF Clone, Rhesus, N-Myc tag CG90253-NM

    Transferrin Receptor cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Transferrin Receptor cDNA ORF Clone in Cloning Vector, Rat RG80098-G
    Transferrin Receptor cDNA ORF Clone, Rat, untagged RG80098-UT
    Transferrin Receptor cDNA ORF Clone, Rat, C-GFPSpark® tag RG80098-ACG
    Transferrin Receptor Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80098-ACGLN
    Transferrin Receptor cDNA ORF Clone, Rat, C-OFPSpark® tag RG80098-ACR
    Transferrin Receptor cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80098-CF
    Transferrin Receptor cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80098-NF
    Transferrin Receptor cDNA ORF Clone, Rat, C-His tag RG80098-CH
    Transferrin Receptor cDNA ORF Clone, Rat, N-His tag RG80098-NH
    Transferrin Receptor cDNA ORF Clone, Rat, C-HA tag RG80098-CY
    Transferrin Receptor cDNA ORF Clone, Rat, N-HA tag RG80098-NY
    Transferrin Receptor cDNA ORF Clone, Rat, C-Myc tag RG80098-CM
    Transferrin Receptor cDNA ORF Clone, Rat, N-Myc tag RG80098-NM
    Transferrin Receptor qPCR Primer Pairs, Rat RP300094

    Transferrin Receptor cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Transferrin Receptor cDNA ORF Clone in Cloning Vector, Mouse MG50741-G
    Transferrin Receptor cDNA ORF Clone, Mouse, untagged MG50741-UT
    Transferrin Receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50741-ACGLN
    Transferrin Receptor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50741-ACG
    Transferrin Receptor cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50741-ANG
    Transferrin Receptor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50741-ACR
    Transferrin Receptor cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50741-ANR
    Transferrin Receptor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50741-CF
    Transferrin Receptor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50741-NF
    Transferrin Receptor cDNA ORF Clone, Mouse, C-His tag MG50741-CH
    Transferrin Receptor cDNA ORF Clone, Mouse, C-HA tag MG50741-CY
    Transferrin Receptor cDNA ORF Clone, Mouse, N-HA tag MG50741-NY
    Transferrin Receptor cDNA ORF Clone, Mouse, C-Myc tag MG50741-CM
    Transferrin Receptor cDNA ORF Clone, Mouse, N-Myc tag MG50741-NM
    Transferrin Receptor qPCR Primer Pairs, Mouse MP200716

    Transferrin Receptor cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Transferrin Receptor cDNA ORF Clone in Cloning Vector, Human HG11020-M
    Transferrin Receptor cDNA ORF Clone, Human, untagged HG11020-UT
    Transferrin Receptor Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11020-ACGLN
    Transferrin Receptor cDNA ORF Clone, Human, C-GFPSpark® tag HG11020-ACG
    Transferrin Receptor cDNA ORF Clone, Human, C-OFPSpark® tag HG11020-ACR
    Transferrin Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11020-CF
    Transferrin Receptor cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11020-NF
    Transferrin Receptor cDNA ORF Clone, Human, C-His tag HG11020-CH
    Transferrin Receptor cDNA ORF Clone, Human, N-His tag HG11020-NH
    Transferrin Receptor cDNA ORF Clone, Human, C-HA tag HG11020-CY
    Transferrin Receptor cDNA ORF Clone, Human, N-HA tag HG11020-NY
    Transferrin Receptor cDNA ORF Clone, Human, C-Myc tag HG11020-CM
    Transferrin Receptor cDNA ORF Clone, Human, N-Myc tag HG11020-NM
    Transferrin Receptor qPCR Primer Pairs, Human HP100016
    info info
    添加购物车成功! 添加购物车失败!