Smad5 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50728-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Smad5 Reagents
CRO Services
Product recommended

All Smad5 Reagents
Smad5 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Description
Full length Clone DNA of Mouse Mothers against decapentaplegic homolog 5 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Smad5 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1110051M15Rik cDNA ORF Clone, Mouse;AI451355 cDNA ORF Clone, Mouse;Dwf-C cDNA ORF Clone, Mouse;Madh5 cDNA ORF Clone, Mouse;MusMLP cDNA ORF Clone, Mouse
Smad5 Background Information

SMAD5 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD5 is involved in the TGF-beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. It is also involved in cell signalling and modulates signals of bone morphogenetic proteins (BMP's). The binding of ligands causes the oligomerization and phosphorylation of the SMAD5 protein. SMAD5 is a receptor regulated SMAD (R-SMAD) and is activated by bone morphogenetic protein type 1 receptor kinase.

Full Name
SMAD family member 5
References
  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Sangadala S. et al., 2007, J Biomol Struct Dyn. 25 (1): 11-23.
  • Riggins GJ. et al., 1996, Nat Genet. 13 (3): 347-9.
  • Smad5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Smad5 cDNA ORF Clone in Cloning Vector, Mouse MG50728-G
    Smad5 cDNA ORF Clone, Mouse, untagged MG50728-UT
    Smad5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50728-ACGLN
    Smad5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50728-ACG
    Smad5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50728-ANG
    Smad5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50728-ACR
    Smad5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50728-ANR
    Smad5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50728-CF
    Smad5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50728-NF
    Smad5 cDNA ORF Clone, Mouse, C-His tag MG50728-CH
    Smad5 cDNA ORF Clone, Mouse, C-HA tag MG50728-CY
    Smad5 cDNA ORF Clone, Mouse, N-HA tag MG50728-NY
    Smad5 cDNA ORF Clone, Mouse, C-Myc tag MG50728-CM
    Smad5 cDNA ORF Clone, Mouse, N-Myc tag MG50728-NM
    Smad5 qPCR Primer Pairs, Mouse MP200703

    Smad5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Smad5 cDNA ORF Clone in Cloning Vector, Human HG10017-M
    Smad5 cDNA ORF Clone, Human, untagged HG10017-UT
    Smad5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10017-ACG
    Smad5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10017-ACGLN
    Smad5 cDNA ORF Clone, Human, N-GFPSpark® tag HG10017-ANG
    Smad5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10017-ACR
    Smad5 cDNA ORF Clone, Human, N-OFPSpark® tag HG10017-ANR
    Smad5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10017-CF
    Smad5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10017-NF
    Smad5 cDNA ORF Clone, Human, C-His tag HG10017-CH
    Smad5 cDNA ORF Clone, Human, N-His tag HG10017-NH
    Smad5 cDNA ORF Clone, Human, C-HA tag HG10017-CY
    Smad5 cDNA ORF Clone, Human, N-HA tag HG10017-NY
    Smad5 cDNA ORF Clone, Human, C-Myc tag HG10017-CM
    Smad5 cDNA ORF Clone, Human, N-Myc tag HG10017-NM
    Smad5 qPCR Primer Pairs, Human HP100114
    info info
    添加购物车成功! 添加购物车失败!