SerpinB8 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50215-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SerpinB8 Reagents
CRO Services
Product recommended

All SerpinB8 Reagents
SerpinB8 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1425 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptdiase inhibitor, clade B, member 8 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SerpinB8 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
CAP-2 cDNA ORF Clone, Mouse;CAP2 cDNA ORF Clone, Mouse;NK10 cDNA ORF Clone, Mouse;ovalbumin cDNA ORF Clone, Mouse;Spi8 cDNA ORF Clone, Mouse
SerpinB8 Background Information

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
Mouse SerpinB8, also known as Cytoplasmic antiproteinase 2, Peptidase inhibitor 8, SerpinB8, PI-8, SERPINB8 and CAP2, is a member of the Serpin superfamily. SERPINB8 was broadly expressed. In normal neuroendocrine tissues, strongest SerpinB8 expression was detected in islets of Langerhans of the pancreas. Moderate SerpinB8 expression was observed in neuroendocrine cells of the thyroid, adrenal cortex, colon, and pituitary gland. In the pancreas, SerpinB8 is specifically expressed by insulin-producing beta cells, and can be used as an additional diagnostic immunohistochemical marker. Mouse SerpinB8 distribution alters during kidney regeneration, possibly to control a prohormone convertase involved in inflammation or tissue repair.

Full Name
serpin peptidase inhibitor, clade B (ovalbumin), member 8
References
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Filleur, S. et al., 2009, J Cell Biochem. 106 (5): 769-75.
  • de Koning, P.J. et al., 2009, Pancreas. 38 (4): 461-7.
  • SerpinB8 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SerpinB8 cDNA ORF Clone in Cloning Vector, Mouse MG50215-M
    SerpinB8 cDNA ORF Clone, Mouse, untagged MG50215-UT
    SerpinB8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50215-ACG
    SerpinB8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50215-ACGLN
    SerpinB8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50215-ANG
    SerpinB8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50215-ACR
    SerpinB8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50215-ANR
    SerpinB8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50215-CF
    SerpinB8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50215-NF
    SerpinB8 cDNA ORF Clone, Mouse, C-His tag MG50215-CH
    SerpinB8 cDNA ORF Clone, Mouse, N-His tag MG50215-NH
    SerpinB8 cDNA ORF Clone, Mouse, C-HA tag MG50215-CY
    SerpinB8 cDNA ORF Clone, Mouse, N-HA tag MG50215-NY
    SerpinB8 cDNA ORF Clone, Mouse, C-Myc tag MG50215-CM
    SerpinB8 qPCR Primer Pairs, Mouse MP200078

    SerpinB8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SerpinB8 cDNA ORF Clone in Cloning Vector, Human HG10999-M
    SerpinB8 cDNA ORF Clone, Human, untagged HG10999-UT
    SerpinB8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10999-ACGLN
    SerpinB8 cDNA ORF Clone, Human, C-GFPSpark® tag HG10999-ACG
    SerpinB8 cDNA ORF Clone, Human, N-GFPSpark® tag HG10999-ANG
    SerpinB8 cDNA ORF Clone, Human, C-OFPSpark® tag HG10999-ACR
    SerpinB8 cDNA ORF Clone, Human, N-OFPSpark® tag HG10999-ANR
    SerpinB8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10999-CF
    SerpinB8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10999-NF
    SerpinB8 cDNA ORF Clone, Human, C-His tag HG10999-CH
    SerpinB8 cDNA ORF Clone, Human, N-His tag HG10999-NH
    SerpinB8 cDNA ORF Clone, Human, C-HA tag HG10999-CY
    SerpinB8 cDNA ORF Clone, Human, N-HA tag HG10999-NY
    SerpinB8 cDNA ORF Clone, Human, C-Myc tag HG10999-CM
    SerpinB8 cDNA ORF Clone, Human, N-Myc tag HG10999-NM
    SerpinB8 qPCR Primer Pairs, Human HP100961
    info info
    添加购物车成功! 添加购物车失败!