ST6GAL1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50740-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ST6GAL1 Reagents
CRO Services
Product recommended

All ST6GAL1 Reagents
ST6GAL1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1212 bp
Description
Full length Clone DNA of Mouse beta galactoside alpha 2,6 sialyltransferase 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ST6GAL1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AW742324 cDNA ORF Clone, Mouse;Siat1 cDNA ORF Clone, Mouse;St6gal cDNA ORF Clone, Mouse;St6Gal-I cDNA ORF Clone, Mouse;St6galI cDNA ORF Clone, Mouse
ST6GAL1 Background Information

Beta-galactoside alpha-2,6-sialyltransferase 1, also known as B-cell antigen CD75, Sialyltransferase 1, CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase 1, ST6GAL1 and SIAT1, is a single-pass type II membrane protein which belongs to the glycosyltransferase 29 family. Sialyltransferases are key enzymes in the biosynthesis of sialoglycoconjugates that catalyze the transfer of sialic residue from its activated form to an oligosaccharidic acceptor. ST6GAL1 / SIAT1 is normally found in the?Golgi?but which can be proteolytically processed to a soluble form. It is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CDw75, and CD76. β-Galactoside α2,6-sialyltransferases ST6GAL1 and ST6GAL2 are the two unique members of the ST6GAL family described in higher vertebrates. ST6GAL1 / SIAT1 transfers sialic acid from the donor of substrate CMP-sialic acid to galactose containing acceptor substrates.

Full Name
ST6 beta-galactosamide alpha-2,6-sialyltranferase 1
References
  • Collins,B.E. et al., 2006, Nat Immunol. 7(2):199-206.
  • Videira,P.A. et al., 2008, Glycoconj J. 25(3): 259-68.
  • Petit,D. et al., 2010, J Biol Chem. 285(49): 38399-414.
  • Kroes,R.A. et al., 2010, Proc Natl Acad Sci USA.107(28):12646-51.
  • ST6GAL1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    ST6GAL1 cDNA ORF Clone in Cloning Vector, Canine DG70229-U
    ST6GAL1 cDNA ORF Clone, Canine, untagged DG70229-UT
    ST6GAL1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70229-ACG
    ST6GAL1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70229-ACGLN
    ST6GAL1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70229-ACR
    ST6GAL1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70229-CF
    ST6GAL1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70229-NF
    ST6GAL1 cDNA ORF Clone, Canine, C-His tag DG70229-CH
    ST6GAL1 cDNA ORF Clone, Canine, N-His tag DG70229-NH
    ST6GAL1 cDNA ORF Clone, Canine, C-HA tag DG70229-CY
    ST6GAL1 cDNA ORF Clone, Canine, N-HA tag DG70229-NY
    ST6GAL1 cDNA ORF Clone, Canine, C-Myc tag DG70229-CM
    ST6GAL1 cDNA ORF Clone, Canine, N-Myc tag DG70229-NM

    ST6GAL1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ST6GAL1 cDNA ORF Clone in Cloning Vector, Rat RG80866-U
    ST6GAL1 cDNA ORF Clone, Rat, untagged RG80866-UT
    ST6GAL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80866-ACGLN
    ST6GAL1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80866-ACG
    ST6GAL1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80866-ACR
    ST6GAL1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80866-CF
    ST6GAL1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80866-NF
    ST6GAL1 cDNA ORF Clone, Rat, C-His tag RG80866-CH
    ST6GAL1 cDNA ORF Clone, Rat, N-His tag RG80866-NH
    ST6GAL1 cDNA ORF Clone, Rat, C-HA tag RG80866-CY
    ST6GAL1 cDNA ORF Clone, Rat, N-HA tag RG80866-NY
    ST6GAL1 cDNA ORF Clone, Rat, C-Myc tag RG80866-CM
    ST6GAL1 cDNA ORF Clone, Rat, N-Myc tag RG80866-NM
    ST6GAL1 qPCR Primer Pairs, Rat RP300830

    ST6GAL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ST6GAL1 cDNA ORF Clone in Cloning Vector, Mouse MG50740-G
    ST6GAL1 cDNA ORF Clone, Mouse, untagged MG50740-UT
    ST6GAL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50740-ACGLN
    ST6GAL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50740-ACG
    ST6GAL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50740-ACR
    ST6GAL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50740-CF
    ST6GAL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50740-NF
    ST6GAL1 cDNA ORF Clone, Mouse, C-His tag MG50740-CH
    ST6GAL1 cDNA ORF Clone, Mouse, C-HA tag MG50740-CY
    ST6GAL1 cDNA ORF Clone, Mouse, N-HA tag MG50740-NY
    ST6GAL1 cDNA ORF Clone, Mouse, C-Myc tag MG50740-CM
    ST6GAL1 cDNA ORF Clone, Mouse, N-Myc tag MG50740-NM
    ST6GAL1 qPCR Primer Pairs, Mouse MP200715

    ST6GAL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ST6GAL1 cDNA ORF Clone in Cloning Vector, Human HG11590-M
    ST6GAL1 cDNA ORF Clone, Human, untagged HG11590-UT
    ST6GAL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11590-ACGLN
    ST6GAL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11590-ACG
    ST6GAL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11590-ACR
    ST6GAL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11590-CF
    ST6GAL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11590-NF
    ST6GAL1 cDNA ORF Clone, Human, C-His tag HG11590-CH
    ST6GAL1 cDNA ORF Clone, Human, N-His tag HG11590-NH
    ST6GAL1 cDNA ORF Clone, Human, C-HA tag HG11590-CY
    ST6GAL1 cDNA ORF Clone, Human, N-HA tag HG11590-NY
    ST6GAL1 cDNA ORF Clone, Human, C-Myc tag HG11590-CM
    ST6GAL1 cDNA ORF Clone, Human, N-Myc tag HG11590-NM
    ST6GAL1 qPCR Primer Pairs, Human HP101455
    info info
    添加购物车成功! 添加购物车失败!