SNX5 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51623-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SNX5 Reagents
CRO Services
Product recommended

All SNX5 Reagents
SNX5 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1215 bp
Description
Full length Clone DNA of Mouse sorting nexin 5 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNX5 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
0910001N05Rik cDNA ORF Clone, Mouse;1810032P22Rik cDNA ORF Clone, Mouse;AU019504 cDNA ORF Clone, Mouse;D2Ertd52e cDNA ORF Clone, Mouse
SNX5 Background Information
Full Name
sorting nexin 5

SNX5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SNX5 cDNA ORF Clone in Cloning Vector, Mouse MG51623-G
SNX5 cDNA ORF Clone, Mouse, untagged MG51623-UT
SNX5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51623-ACGLN
SNX5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51623-ACG
SNX5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51623-ANG
SNX5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51623-ACR
SNX5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51623-ANR
SNX5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51623-CF
SNX5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51623-NF
SNX5 cDNA ORF Clone, Mouse, C-His tag MG51623-CH
SNX5 cDNA ORF Clone, Mouse, N-His tag MG51623-NH
SNX5 cDNA ORF Clone, Mouse, C-HA tag MG51623-CY
SNX5 cDNA ORF Clone, Mouse, N-HA tag MG51623-NY
SNX5 cDNA ORF Clone, Mouse, N-Myc tag MG51623-NM
SNX5 qPCR Primer Pairs, Mouse MP201496

SNX5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SNX5 cDNA ORF Clone in Cloning Vector, Human HG21391-U
SNX5 cDNA ORF Clone, Human, untagged HG21391-UT
SNX5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21391-ACGLN
SNX5 cDNA ORF Clone, Human, C-GFPSpark® tag HG21391-ACG
SNX5 cDNA ORF Clone, Human, N-GFPSpark® tag HG21391-ANG
SNX5 cDNA ORF Clone, Human, C-OFPSpark® tag HG21391-ACR
SNX5 cDNA ORF Clone, Human, N-OFPSpark® tag HG21391-ANR
SNX5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21391-CF
SNX5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21391-NF
SNX5 cDNA ORF Clone, Human, C-His tag HG21391-CH
SNX5 cDNA ORF Clone, Human, N-His tag HG21391-NH
SNX5 cDNA ORF Clone, Human, C-HA tag HG21391-CY
SNX5 cDNA ORF Clone, Human, N-HA tag HG21391-NY
SNX5 cDNA ORF Clone, Human, C-Myc tag HG21391-CM
SNX5 cDNA ORF Clone, Human, N-Myc tag HG21391-NM
info info
添加购物车成功! 添加购物车失败!