SLC25A39 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52785-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SLC25A39 Reagents
CRO Services
Product recommended

All SLC25A39 Reagents
SLC25A39 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Mouse solute carrier family 25, member 39 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A39 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
3010027G13Rik cDNA ORF Clone, Mouse;D11Ertd333e cDNA ORF Clone, Mouse
SLC25A39 Background Information
Full Name
solute carrier family 25, member 39

SLC25A39 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC25A39 cDNA ORF Clone in Cloning Vector, Rat RG80999-U
SLC25A39 cDNA ORF Clone, Rat, untagged RG80999-UT
SLC25A39 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80999-ACG
SLC25A39 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80999-ACGLN
SLC25A39 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80999-ANG
SLC25A39 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80999-ACR
SLC25A39 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80999-ANR
SLC25A39 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80999-CF
SLC25A39 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80999-NF
SLC25A39 cDNA ORF Clone, Rat, C-His tag RG80999-CH
SLC25A39 cDNA ORF Clone, Rat, N-His tag RG80999-NH
SLC25A39 cDNA ORF Clone, Rat, C-HA tag RG80999-CY
SLC25A39 cDNA ORF Clone, Rat, N-HA tag RG80999-NY
SLC25A39 cDNA ORF Clone, Rat, C-Myc tag RG80999-CM
SLC25A39 cDNA ORF Clone, Rat, N-Myc tag RG80999-NM
SLC25A39 qPCR Primer Pairs, Rat RP300963

SLC25A39 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A39 cDNA ORF Clone in Cloning Vector, Mouse MG52785-G
SLC25A39 cDNA ORF Clone, Mouse, untagged MG52785-UT
SLC25A39 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52785-ACG
SLC25A39 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52785-ACGLN
SLC25A39 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52785-ANG
SLC25A39 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52785-ACR
SLC25A39 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52785-ANR
SLC25A39 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52785-NF
SLC25A39 cDNA ORF Clone, Mouse, C-His tag MG52785-CH
SLC25A39 cDNA ORF Clone, Mouse, N-His tag MG52785-NH
SLC25A39 cDNA ORF Clone, Mouse, C-HA tag MG52785-CY
SLC25A39 cDNA ORF Clone, Mouse, N-HA tag MG52785-NY
SLC25A39 cDNA ORF Clone, Mouse, C-Myc tag MG52785-CM
SLC25A39 cDNA ORF Clone, Mouse, N-Myc tag MG52785-NM

SLC25A39 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A39 cDNA ORF Clone in Cloning Vector, Human HG16416-U
SLC25A39 cDNA ORF Clone, Human, untagged HG16416-UT
SLC25A39 cDNA ORF Clone, Human, C-GFPSpark® tag HG16416-ACG
SLC25A39 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16416-ACGLN
SLC25A39 cDNA ORF Clone, Human, N-GFPSpark® tag HG16416-ANG
SLC25A39 cDNA ORF Clone, Human, C-OFPSpark® tag HG16416-ACR
SLC25A39 cDNA ORF Clone, Human, N-OFPSpark® tag HG16416-ANR
SLC25A39 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16416-CF
SLC25A39 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16416-NF
SLC25A39 cDNA ORF Clone, Human, C-His tag HG16416-CH
SLC25A39 cDNA ORF Clone, Human, N-His tag HG16416-NH
SLC25A39 cDNA ORF Clone, Human, C-HA tag HG16416-CY
SLC25A39 cDNA ORF Clone, Human, N-HA tag HG16416-NY
SLC25A39 cDNA ORF Clone, Human, C-Myc tag HG16416-CM
SLC25A39 cDNA ORF Clone, Human, N-Myc tag HG16416-NM
SLC25A39 qPCR Primer Pairs, Human HP105165
info info
添加购物车成功! 添加购物车失败!