SLAMF7/CD319 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50201-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SLAMF7/CD319 Reagents
CRO Services
Product recommended

All SLAMF7/CD319 Reagents
SLAMF7/CD319 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1002 bp
Description
Full length Clone DNA of Mouse SLAM family member 7 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLAMF7/CD319 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
19A cDNA ORF Clone, Mouse;19A24 cDNA ORF Clone, Mouse;4930560D03Rik cDNA ORF Clone, Mouse;CRACC cDNA ORF Clone, Mouse;CS1 cDNA ORF Clone, Mouse
SLAMF7/CD319 Background Information

SLAM family member 7 (SLAMF7), also known as CRACC, CD319, CD2-like receptor-activating cytotoxic cells, and CS1, is a single-pass type I membrane protein and a member of the CD2 family of cell surface receptors. SLAMF7 is expressed in NK cells, activated B-cells, NK-cell line but not in promyelocytic, B-cell lines, or T-cell lines. Although the cytoplasmic domain of CS1 contains immunoreceptor tyrosine-based switch motifs (ITSM), which enables to recruite signaling lymphocyte activation molecule (SLAM)-associated protein (SAP/SH2D1A), it activates NK cells in the absence of a functional SAP. CS1 is a self ligand and homophilic interaction of CS1 regulates NK cell cytolytic activity. CRACC positively regulated natural killer cell functions by a mechanism dependent on the adaptor EAT-2 but not the related adaptor SAP. However, in the absence of EAT-2, CRACC potently inhibited natural killer cell function. It was also inhibitory in T cells, which are typically devoid of EAT-2. Thus, CRACC can exert activating or inhibitory influences on cells of the immune system depending on cellular context and the availability of effector proteins.

Full Name
SLAM family member 7
References
  • Lee JK, et al. (2004) Molecular and functional characterization of a CS1 (CRACC) splice variant expressed in human NK cells that does not contain immunoreceptor tyrosine-based switch motifs. Eur J Immunol. 34(10): 2791-9.
  • Tassi I, et al. (2005) The cytotoxicity receptor CRACC (CS-1) recruits EAT-2 and activates the PI3K and phospholipase Cgamma signaling pathways in human NK cells. J Immunol. 175(12): 7996-8002.
  • Lee JK, et al. (2007) CS1 (CRACC, CD319) induces proliferation and autocrine cytokine expression on human B lymphocytes. J Immunol. 179(7): 4672-8.
  • Cruz-Munoz ME, et al. (2009) Influence of CRACC, a SLAM family receptor coupled to the adaptor EAT-2, on natural killer cell function. Nat Immunol. 10(3): 297-305.
  • SLAMF7/CD319 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SLAMF7/CD319 cDNA ORF Clone in Cloning Vector, Mouse MG50201-M
    SLAMF7/CD319 cDNA ORF Clone, Mouse, untagged MG50201-UT
    SLAMF7/CD319 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50201-ACGLN
    SLAMF7/CD319 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50201-ACG
    SLAMF7/CD319 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50201-ACR
    SLAMF7/CD319 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50201-CF
    SLAMF7/CD319 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50201-NF
    SLAMF7/CD319 cDNA ORF Clone, Mouse, C-His tag MG50201-CH
    SLAMF7/CD319 cDNA ORF Clone, Mouse, N-His tag MG50201-NH
    SLAMF7/CD319 cDNA ORF Clone, Mouse, C-HA tag MG50201-CY
    SLAMF7/CD319 cDNA ORF Clone, Mouse, N-HA tag MG50201-NY
    SLAMF7/CD319 cDNA ORF Clone, Mouse, C-Myc tag MG50201-CM
    SLAMF7/CD319 qPCR Primer Pairs, Mouse MP200230

    SLAMF7/CD319 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SLAMF7/CD319 cDNA ORF Clone in Cloning Vector, Human HG11691-G
    SLAMF7/CD319 cDNA ORF Clone, Human, untagged HG11691-UT
    SLAMF7/CD319 cDNA ORF Clone, Human, C-GFPSpark® tag HG11691-ACG
    SLAMF7/CD319 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11691-ACGLN
    SLAMF7/CD319 cDNA ORF Clone, Human, C-OFPSpark® tag HG11691-ACR
    SLAMF7/CD319 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11691-G-F
    SLAMF7/CD319 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11691-CF
    SLAMF7/CD319 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11691-NF
    SLAMF7/CD319 cDNA ORF Clone, Human, C-His tag HG11691-CH
    SLAMF7/CD319 cDNA ORF Clone, Human, N-His tag HG11691-NH
    SLAMF7/CD319 cDNA ORF Clone, Human, C-HA tag HG11691-CY
    SLAMF7/CD319 cDNA ORF Clone, Human, N-HA tag HG11691-NY
    SLAMF7/CD319 cDNA ORF Clone, Human, C-Myc tag HG11691-CM
    SLAMF7/CD319 cDNA ORF Clone, Human, N-Myc tag HG11691-NM
    SLAMF7/CD319 qPCR Primer Pairs, Human HP101517
    info info
    添加购物车成功! 添加购物车失败!