SH3BGRL3 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52787-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SH3BGRL3 Reagents
CRO Services
Product recommended

All SH3BGRL3 Reagents
SH3BGRL3 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
282 bp
Description
Full length Clone DNA of Mouse SH3 domain binding glutamic acid-rich protein-like 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SH3BGRL3 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1110004L05Rik cDNA ORF Clone, Mouse;AU022188 cDNA ORF Clone, Mouse
SH3BGRL3 Background Information
Full Name
SH3 domain binding glutamate-rich protein like 3

SH3BGRL3 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
SH3BGRL3 cDNA ORF Clone in Cloning Vector, Ferret FG60100-G
SH3BGRL3 cDNA ORF Clone, Ferret, untagged FG60100-UT
SH3BGRL3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60100-ACG
SH3BGRL3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60100-ACGLN
SH3BGRL3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60100-ANG
SH3BGRL3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60100-ACR
SH3BGRL3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60100-ANR
SH3BGRL3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60100-CF
SH3BGRL3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60100-NF
SH3BGRL3 cDNA ORF Clone, Ferret, C-His tag FG60100-CH
SH3BGRL3 cDNA ORF Clone, Ferret, N-His tag FG60100-NH
SH3BGRL3 cDNA ORF Clone, Ferret, C-HA tag FG60100-CY
SH3BGRL3 cDNA ORF Clone, Ferret, N-HA tag FG60100-NY
SH3BGRL3 cDNA ORF Clone, Ferret, C-Myc tag FG60100-CM
SH3BGRL3 cDNA ORF Clone, Ferret, N-Myc tag FG60100-NM

SH3BGRL3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SH3BGRL3 cDNA ORF Clone in Cloning Vector, Rat RG80768-U
SH3BGRL3 cDNA ORF Clone, Rat, untagged RG80768-UT
SH3BGRL3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80768-ACG
SH3BGRL3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80768-ACGLN
SH3BGRL3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80768-ANG
SH3BGRL3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80768-ACR
SH3BGRL3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80768-ANR
SH3BGRL3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80768-CF
SH3BGRL3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80768-NF
SH3BGRL3 cDNA ORF Clone, Rat, C-His tag RG80768-CH
SH3BGRL3 cDNA ORF Clone, Rat, N-His tag RG80768-NH
SH3BGRL3 cDNA ORF Clone, Rat, C-HA tag RG80768-CY
SH3BGRL3 cDNA ORF Clone, Rat, N-HA tag RG80768-NY
SH3BGRL3 cDNA ORF Clone, Rat, C-Myc tag RG80768-CM
SH3BGRL3 cDNA ORF Clone, Rat, N-Myc tag RG80768-NM
SH3BGRL3 qPCR Primer Pairs, Rat RP300732

SH3BGRL3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SH3BGRL3 cDNA ORF Clone in Cloning Vector, Mouse MG52787-G
SH3BGRL3 cDNA ORF Clone, Mouse, untagged MG52787-UT
SH3BGRL3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52787-ACG
SH3BGRL3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52787-ACGLN
SH3BGRL3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52787-ANG
SH3BGRL3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52787-ACR
SH3BGRL3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52787-ANR
SH3BGRL3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52787-CF
SH3BGRL3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52787-NF
SH3BGRL3 cDNA ORF Clone, Mouse, C-His tag MG52787-CH
SH3BGRL3 cDNA ORF Clone, Mouse, N-His tag MG52787-NH
SH3BGRL3 cDNA ORF Clone, Mouse, C-HA tag MG52787-CY
SH3BGRL3 cDNA ORF Clone, Mouse, N-HA tag MG52787-NY
SH3BGRL3 cDNA ORF Clone, Mouse, N-Myc tag MG52787-NM

SH3BGRL3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SH3BGRL3 cDNA ORF Clone in Cloning Vector, Human HG17037-U
SH3BGRL3 cDNA ORF Clone, Human, untagged HG17037-UT
SH3BGRL3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17037-ACGLN
SH3BGRL3 cDNA ORF Clone, Human, C-GFPSpark® tag HG17037-ACG
SH3BGRL3 cDNA ORF Clone, Human, N-GFPSpark® tag HG17037-ANG
SH3BGRL3 cDNA ORF Clone, Human, C-OFPSpark® tag HG17037-ACR
SH3BGRL3 cDNA ORF Clone, Human, N-OFPSpark® tag HG17037-ANR
SH3BGRL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17037-CF
SH3BGRL3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17037-NF
SH3BGRL3 cDNA ORF Clone, Human, C-His tag HG17037-CH
SH3BGRL3 cDNA ORF Clone, Human, N-His tag HG17037-NH
SH3BGRL3 cDNA ORF Clone, Human, C-HA tag HG17037-CY
SH3BGRL3 cDNA ORF Clone, Human, N-HA tag HG17037-NY
SH3BGRL3 cDNA ORF Clone, Human, C-Myc tag HG17037-CM
SH3BGRL3 cDNA ORF Clone, Human, N-Myc tag HG17037-NM
info info
添加购物车成功! 添加购物车失败!