SerpinD1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50121-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SerpinD1 Reagents
CRO Services
Product recommended

All SerpinD1 Reagents
SerpinD1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1437 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade D, member 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SerpinD1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AA985900 cDNA ORF Clone, Mouse;AI30344 6 cDNA ORF Clone, Mouse;AI303446 cDNA ORF Clone, Mouse;Hcf2 cDNA ORF Clone, Mouse;HCII cDNA ORF Clone, Mouse;MGC107662 cDNA ORF Clone, Mouse;Serpind1 cDNA ORF Clone, Mouse
SerpinD1 Background Information

SerpinD1, also known as heparin cofactor II (HCâ…¡), is a member of Serpin superfamily of the serine proteinase inhibitors. HCII is a glycoprotein in human plasma that inhibits thrombin and chymotrypsin, and the rate of inhibition of thrombin is rapidly increased by Dermatan sulfate (DS), heparin (H) and glycosaminoglycans(GAG). The stimulatory effect of glycosaminoglycans on the inhibition is mediated, in part, by the N-terminal acidic domain of HCII. Interestingly, a C-terminal His-tagged recombinant HCII exhibits enhanced activity of thrombin inhibition. It has been suggested that HCII plays an unique and important role in vascular homeostasis, and accordingly mutations in this gene or congenital HCII deficiency is potentially associated with thrombosis. HCII specifically inhibits thrombin action at the site of vascular wall injury and HCII-thrombin complexes have been detected in human plasma. HCII protects against thrombin-induced vascular remodeling in both humans and mice and suggest that HCII is a predictive biomarker and therapeutic target for atherosclerosis. SerpinD1 also inhibits chymotrypsin, but in a glycosaminoglycan-independent manner.

Full Name
serpin peptidase inhibitor, clade D (heparin cofactor), member 1
References
  • Rau JC, et al. (2009) Heparin cofactor II in atherosclerotic lesions from the Pathobiological Determinants of Atherosclerosis in Youth (PDAY) study. Exp Mol Pathol. 87(3): 178-83.
  • Aihara K, et al. (2009) Heparin cofactor II as a novel vascular protective factor against atherosclerosis. J Atheroscler Thromb. 16(5): 523-31.
  • SerpinD1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SerpinD1 cDNA ORF Clone in Cloning Vector, Mouse MG50121-M
    SerpinD1 cDNA ORF Clone, Mouse, untagged MG50121-UT
    SerpinD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50121-ACGLN
    SerpinD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50121-ACG
    SerpinD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50121-ACR
    SerpinD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50121-CF
    SerpinD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50121-NF
    SerpinD1 cDNA ORF Clone, Mouse, C-His tag MG50121-CH
    SerpinD1 cDNA ORF Clone, Mouse, C-HA tag MG50121-CY
    SerpinD1 cDNA ORF Clone, Mouse, N-HA tag MG50121-NY
    SerpinD1 cDNA ORF Clone, Mouse, C-Myc tag MG50121-CM
    SerpinD1 cDNA ORF Clone, Mouse, N-Myc tag MG50121-NM
    SerpinD1 qPCR Primer Pairs, Mouse MP200151

    SerpinD1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SerpinD1 cDNA ORF Clone in Cloning Vector, Human HG10295-M
    SerpinD1 cDNA ORF Clone, Human, untagged HG10295-UT
    SerpinD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10295-ACG
    SerpinD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10295-ACGLN
    SerpinD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10295-ACR
    SerpinD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10295-CF
    SerpinD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10295-NF
    SerpinD1 cDNA ORF Clone, Human, C-His tag HG10295-CH
    SerpinD1 cDNA ORF Clone, Human, N-His tag HG10295-NH
    SerpinD1 cDNA ORF Clone, Human, C-HA tag HG10295-CY
    SerpinD1 cDNA ORF Clone, Human, N-HA tag HG10295-NY
    SerpinD1 cDNA ORF Clone, Human, C-Myc tag HG10295-CM
    SerpinD1 cDNA ORF Clone, Human, N-Myc tag HG10295-NM
    SerpinD1 qPCR Primer Pairs, Human HP100340
    info info
    添加购物车成功! 添加购物车失败!