SerpinB6 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50374-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SerpinB6 Reagents
CRO Services
Product recommended

All SerpinB6 Reagents
SerpinB6 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1137 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade B, member 6a with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SerpinB6 Background Information

SerpinB6, also known as Cytoplasmic antiproteinase, Peptidase inhibitor 6, Placental thrombin inhibitor, SERPINB6 and PI-6, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB6 / PI-6 is an inhibitor of cathepsin G, kallikrein-8 and thrombin. It may play an important role in the inner ear in the protection against leakage of lysosomal content during stress and loss of this protection results in cell death and sensorineural hearing loss. SerpinB6 / PI-6 is expressed in keratinocytes (at protein level). It is also found in placenta, cardiac muscle, lung, liver, kidney and pancreas. SerpinB6 / PI-6 is expressed in the inner ear hair cells. It expressed abundantly by normal mast cells in different tissues and by mast cells in mastocytoma lesions. SerpinB6 / PI-6 may be involved in the regulation of serine proteinases present in the brain or extravasated from the blood. Defects in SerpinB6 are the cause of deafness autosomal recessive type 91 which is a form of non-syndromic deafness characterized by progressive and age-dependent sensorineural hearing loss. Vestibular function is normal.

Full Name
serpin peptidase inhibitor, clade B (ovalbumin), member 6
References
  • Morgenstern KA. et al.,1994, Biochemistry. 33: 3432-41.
  • Strik MC. et al., 2004, Blood. 103: 2710-7.
  • Scott FL. et al., 2007, J Biochem. 142: 435-42.
  • Burkard TR. et al., 2011, BMC Syst Biol. 5:17.
  • SerpinB6 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SerpinB6 cDNA ORF Clone in Cloning Vector, Rat RG87926-U
    SerpinB6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87926-ACGLN

    SerpinB6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SerpinB6 cDNA ORF Clone in Cloning Vector, Mouse MG50374-M
    SerpinB6 cDNA ORF Clone, Mouse, untagged MG50374-UT
    SerpinB6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50374-ACG
    SerpinB6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50374-ACGLN
    SerpinB6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50374-ANG
    SerpinB6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50374-ACR
    SerpinB6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50374-ANR
    SerpinB6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50374-CF
    SerpinB6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50374-NF
    SerpinB6 cDNA ORF Clone, Mouse, C-His tag MG50374-CH
    SerpinB6 cDNA ORF Clone, Mouse, N-His tag MG50374-NH
    SerpinB6 cDNA ORF Clone, Mouse, C-HA tag MG50374-CY
    SerpinB6 cDNA ORF Clone, Mouse, N-HA tag MG50374-NY
    SerpinB6 cDNA ORF Clone, Mouse, N-Myc tag MG50374-NM
    SerpinB6 qPCR Primer Pairs, Mouse MP200394

    SerpinB6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SerpinB6 cDNA ORF Clone in Cloning Vector, Human HG16221-G
    SerpinB6 cDNA ORF Clone in Cloning Vector, Human HG29740-U
    SerpinB6 cDNA ORF Clone, Human, untagged HG16221-UT
    SerpinB6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16221-ACGLN
    SerpinB6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16221-ACG
    SerpinB6 cDNA ORF Clone, Human, N-GFPSpark® tag HG16221-ANG
    SerpinB6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16221-ACR
    SerpinB6 cDNA ORF Clone, Human, N-OFPSpark® tag HG16221-ANR
    SerpinB6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16221-CF
    SerpinB6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16221-NF
    SerpinB6 cDNA ORF Clone, Human, C-His tag HG16221-CH
    SerpinB6 cDNA ORF Clone, Human, N-His tag HG16221-NH
    SerpinB6 cDNA ORF Clone, Human, C-HA tag HG16221-CY
    SerpinB6 cDNA ORF Clone, Human, N-HA tag HG16221-NY
    SerpinB6 cDNA ORF Clone, Human, C-Myc tag HG16221-CM
    SerpinB6 cDNA ORF Clone, Human, N-Myc tag HG16221-NM
    SerpinB6 qPCR Primer Pairs, Human HP104986
    info info
    添加购物车成功! 添加购物车失败!