SEMA4A cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50330-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SEMA4A Reagents
CRO Services
Product recommended

All SEMA4A Reagents
SEMA4A cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2283 bp
Description
Full length Clone DNA of Mouse sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A, transcript variant 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SEMA4A cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AI132332 cDNA ORF Clone, Mouse;Semab cDNA ORF Clone, Mouse;SemB cDNA ORF Clone, Mouse
SEMA4A Background Information

Semaphorin-4A, also known as Semaphorin-B, SEMA4A, Sema B and SEMAB, is a single-pass type I  membrane protein which belongs to the semaphorin family. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. Semaphorin-4A / SEMA4A contains one Ig-like C2-type (immunoglobulin-like) domain, one PSI domain and one Sema domain. Defects in SEMA4A are the cause of retinitis pigmentosa type 35 (RP35) which leads to degeneration of retinal photoreceptor cells. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. Defects in SEMA4A are also the cause of cone-rod dystrophy type 10 (CORD10) which are inherited retinal dystrophies belonging to the group of pigmentary retinopathies. CORDs are characterized by retinal pigment deposits visible on fundus examination, predominantly in the macular region, and initial loss of cone photoreceptors followed by rod degeneration.

Semaphorins are secreted, transmembrane, and GPI-linked proteins, defined by cysteine-rich semaphorin protein domains, that have important roles in a variety of tissues. Humans have 20 semaphorins, Drosophila has five, and two are known from DNA viruses. Semaphorins are found in nematodes and crustaceans but not in non-animals. They are grouped into eight classes on the basis of phylogenetic tree analyses and the presence of additional protein motifs. Semaphorins have been implicated in diverse developmental processes such as axon guidance during nervous system development and regulation of cell migration.

Full Name
semaphorin 4A
References
  • Clark H.F., et al., 2003, Genome Res. 13: 2265-2270.
  • Ota T., et al., 2004,Nat. Genet. 36: 40-45.
  • Neufeld, G. et al., 2005, Front Biosci. 10 : 751-60.
  • Fiore,R. et al., 2005, Mol Cell Biol. 25 (6):2310-9.
  • Abid A., et al., 2006, J. Med. Genet. 43:378-381.
  • info info
    添加购物车成功! 添加购物车失败!