SDHAF2 cDNA ORF Clone, Mouse, untagged

Cat: MG52467-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SDHAF2 Reagents
CRO Services
Product recommended

All SDHAF2 Reagents
SDHAF2 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
495 bp
Description
Full length Clone DNA of Mouse succinate dehydrogenase complex assembly factor 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SDHAF2 cDNA ORF Clone, Mouse, untagged Alternative Names
0610038F07Rik cDNA ORF Clone, Mouse;AA407634 cDNA ORF Clone, Mouse;AW049997 cDNA ORF Clone, Mouse
SDHAF2 Background Information
Full Name
succinate dehydrogenase complex assembly factor 2

SDHAF2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SDHAF2 cDNA ORF Clone in Cloning Vector, Rhesus CG90680-G
SDHAF2 cDNA ORF Clone, Rhesus, untagged CG90680-UT
SDHAF2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90680-ACGLN
SDHAF2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90680-ACG
SDHAF2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90680-ANG
SDHAF2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90680-ACR
SDHAF2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90680-ANR
SDHAF2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90680-CF
SDHAF2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90680-NF
SDHAF2 cDNA ORF Clone, Rhesus, C-His tag CG90680-CH
SDHAF2 cDNA ORF Clone, Rhesus, N-His tag CG90680-NH
SDHAF2 cDNA ORF Clone, Rhesus, C-HA tag CG90680-CY
SDHAF2 cDNA ORF Clone, Rhesus, N-HA tag CG90680-NY
SDHAF2 cDNA ORF Clone, Rhesus, C-Myc tag CG90680-CM
SDHAF2 cDNA ORF Clone, Rhesus, N-Myc tag CG90680-NM

SDHAF2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SDHAF2 cDNA ORF Clone in Cloning Vector, Rat RG81241-U
SDHAF2 cDNA ORF Clone, Rat, untagged RG81241-UT
SDHAF2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81241-ACGLN
SDHAF2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81241-ACG
SDHAF2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81241-ANG
SDHAF2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81241-ACR
SDHAF2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81241-ANR
SDHAF2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81241-CF
SDHAF2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81241-NF
SDHAF2 cDNA ORF Clone, Rat, C-His tag RG81241-CH
SDHAF2 cDNA ORF Clone, Rat, N-His tag RG81241-NH
SDHAF2 cDNA ORF Clone, Rat, C-HA tag RG81241-CY
SDHAF2 cDNA ORF Clone, Rat, N-HA tag RG81241-NY
SDHAF2 cDNA ORF Clone, Rat, C-Myc tag RG81241-CM
SDHAF2 cDNA ORF Clone, Rat, N-Myc tag RG81241-NM
SDHAF2 qPCR Primer Pairs, Rat RP301197

SDHAF2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SDHAF2 cDNA ORF Clone in Cloning Vector, Mouse MG52467-G
SDHAF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52467-ACG
SDHAF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52467-ACGLN
SDHAF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52467-ANG
SDHAF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52467-ACR
SDHAF2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52467-ANR
SDHAF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52467-CF
SDHAF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52467-NF
SDHAF2 cDNA ORF Clone, Mouse, C-His tag MG52467-CH
SDHAF2 cDNA ORF Clone, Mouse, N-His tag MG52467-NH
SDHAF2 cDNA ORF Clone, Mouse, C-HA tag MG52467-CY
SDHAF2 cDNA ORF Clone, Mouse, N-HA tag MG52467-NY
SDHAF2 cDNA ORF Clone, Mouse, C-Myc tag MG52467-CM
SDHAF2 cDNA ORF Clone, Mouse, N-Myc tag MG52467-NM
SDHAF2 qPCR Primer Pairs, Mouse MP202340

SDHAF2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SDHAF2 cDNA ORF Clone in Cloning Vector, Human HG16792-U
SDHAF2 cDNA ORF Clone, Human, untagged HG16792-UT
SDHAF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16792-ACGLN
SDHAF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16792-ACG
SDHAF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16792-ANG
SDHAF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16792-ACR
SDHAF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16792-ANR
SDHAF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16792-CF
SDHAF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16792-NF
SDHAF2 cDNA ORF Clone, Human, C-His tag HG16792-CH
SDHAF2 cDNA ORF Clone, Human, N-His tag HG16792-NH
SDHAF2 cDNA ORF Clone, Human, C-HA tag HG16792-CY
SDHAF2 cDNA ORF Clone, Human, N-HA tag HG16792-NY
SDHAF2 cDNA ORF Clone, Human, C-Myc tag HG16792-CM
SDHAF2 cDNA ORF Clone, Human, N-Myc tag HG16792-NM
info info
添加购物车成功! 添加购物车失败!