S100A9 cDNA ORF Clone, Mouse, untagged

Cat: MG50284-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All S100A9 Reagents
CRO Services
Product recommended

All S100A9 Reagents
S100A9 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
342 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse S100 calcium binding protein A9 (calgranulin B).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 0.34kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
S100A9 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A9 cDNA ORF Clone, Mouse, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
S100A9 cDNA ORF Clone, Mouse, untagged Alternative Names
60B8Ag cDNA ORF Clone, Mouse;AW546964 cDNA ORF Clone, Mouse;BEE22 cDNA ORF Clone, Mouse;Cagb cDNA ORF Clone, Mouse;GAGB cDNA ORF Clone, Mouse;L1Ag cDNA ORF Clone, Mouse;MRP14 cDNA ORF Clone, Mouse;p14 cDNA ORF Clone, Mouse
S100A9 Background Information

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. Protein S100-A9, also known as S100 calcium-binding protein A9, S100A9, and CAGB, is a member of the S-100 family. S100A9 is expressed by macrophages in acutely inflammed tissues and in chronic inflammation. It is also expressed in epithelial cells constitutively or induced during dermatoses. S100A9 is a calcium-binding protein. It has anti-microbial activity towards bacteria and fungi. The anti-microbial and proapoptotic activity of S100A9 is inhibited by zinc ions. S100A9 plays a role in the development of endotoxic shock in response to bacterial lipopolysaccharide (LPS). It promotes tubulin polymerization when unphosphorylated. It also promotes phagocyte migration and infiltration of granulocytes at sites of wounding. S100A9 plays a role as a pro-inflammatory mediator in acute and chronic inflammation and up-regulates the release of IL8 and cell-surface expression of ICAM1.

Full Name
S100 calcium binding protein A9
References
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Fanò G. et al., 1995, Prog Neurobiol. 46 (1): 71-82.
  • Vogl T. et al., 2004, Blood. 104: 4260-8.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • S100A9 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    S100A9 cDNA ORF Clone in Cloning Vector, Mouse MG50284-M
    S100A9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50284-ACGLN
    S100A9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50284-ACG
    S100A9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50284-ACR
    S100A9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50284-CF
    S100A9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50284-NF
    S100A9 cDNA ORF Clone, Mouse, C-His tag MG50284-CH
    S100A9 cDNA ORF Clone, Mouse, N-His tag MG50284-NH
    S100A9 cDNA ORF Clone, Mouse, C-HA tag MG50284-CY
    S100A9 cDNA ORF Clone, Mouse, N-HA tag MG50284-NY
    S100A9 cDNA ORF Clone, Mouse, C-Myc tag MG50284-CM
    S100A9 cDNA ORF Clone, Mouse, N-Myc tag MG50284-NM
    S100A9 qPCR Primer Pairs, Mouse MP200308

    S100A9 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    S100A9 cDNA ORF Clone in Cloning Vector, Human HG11145-M
    S100A9 cDNA ORF Clone, Human, untagged HG11145-UT
    S100A9 cDNA ORF Clone, Human, C-GFPSpark® tag HG11145-ACG
    S100A9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11145-ACGLN
    S100A9 cDNA ORF Clone, Human, N-GFPSpark® tag HG11145-ANG
    S100A9 cDNA ORF Clone, Human, C-OFPSpark® tag HG11145-ACR
    S100A9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11145-CF
    S100A9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11145-NF
    S100A9 cDNA ORF Clone, Human, C-His tag HG11145-CH
    S100A9 cDNA ORF Clone, Human, N-His tag HG11145-NH
    S100A9 cDNA ORF Clone, Human, C-HA tag HG11145-CY
    S100A9 cDNA ORF Clone, Human, N-HA tag HG11145-NY
    S100A9 cDNA ORF Clone, Human, C-Myc tag HG11145-CM
    S100A9 cDNA ORF Clone, Human, N-Myc tag HG11145-NM
    S100A9 qPCR Primer Pairs, Human HP100072
    info info
    添加购物车成功! 添加购物车失败!