RRAGC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52206-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RRAGC Reagents
CRO Services
Product recommended

All RRAGC Reagents
RRAGC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1197 bp
Description
Full length Clone DNA of Mouse Ras-related GTP binding C with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RRAGC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
AU041672 cDNA ORF Clone, Mouse;Gtr2 cDNA ORF Clone, Mouse;RAGC cDNA ORF Clone, Mouse;TIB929 cDNA ORF Clone, Mouse;YGR163W cDNA ORF Clone, Mouse
RRAGC Background Information
Full Name
Ras-related GTP binding C

RRAGC cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RRAGC cDNA ORF Clone in Cloning Vector, Rat RG88944-U
RRAGC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88944-ACGLN

RRAGC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RRAGC cDNA ORF Clone in Cloning Vector, Mouse MG52206-G
RRAGC cDNA ORF Clone, Mouse, untagged MG52206-UT
RRAGC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52206-ACGLN
RRAGC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52206-ACG
RRAGC cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52206-ANG
RRAGC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52206-ACR
RRAGC cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52206-ANR
RRAGC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52206-NF
RRAGC cDNA ORF Clone, Mouse, C-His tag MG52206-CH
RRAGC cDNA ORF Clone, Mouse, N-His tag MG52206-NH
RRAGC cDNA ORF Clone, Mouse, C-HA tag MG52206-CY
RRAGC cDNA ORF Clone, Mouse, N-HA tag MG52206-NY
RRAGC cDNA ORF Clone, Mouse, C-Myc tag MG52206-CM
RRAGC cDNA ORF Clone, Mouse, N-Myc tag MG52206-NM
RRAGC qPCR Primer Pairs, Mouse MP202079

RRAGC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RRAGC cDNA ORF Clone in Cloning Vector, Human HG14777-G
RRAGC cDNA ORF Clone, Human, untagged HG14777-UT
RRAGC cDNA ORF Clone, Human, C-GFPSpark® tag HG14777-ACG
RRAGC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14777-ACGLN
RRAGC cDNA ORF Clone, Human, N-GFPSpark® tag HG14777-ANG
RRAGC cDNA ORF Clone, Human, C-OFPSpark® tag HG14777-ACR
RRAGC cDNA ORF Clone, Human, N-OFPSpark® tag HG14777-ANR
RRAGC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14777-CF
RRAGC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14777-NF
RRAGC cDNA ORF Clone, Human, C-His tag HG14777-CH
RRAGC cDNA ORF Clone, Human, N-His tag HG14777-NH
RRAGC cDNA ORF Clone, Human, C-HA tag HG14777-CY
RRAGC cDNA ORF Clone, Human, N-HA tag HG14777-NY
RRAGC cDNA ORF Clone, Human, C-Myc tag HG14777-CM
RRAGC cDNA ORF Clone, Human, N-Myc tag HG14777-NM
RRAGC qPCR Primer Pairs, Human HP103410
info info
添加购物车成功! 添加购物车失败!