RPS14 cDNA ORF Clone, Mouse, untagged

Cat: MG51360-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPS14 Reagents
CRO Services
Product recommended

All RPS14 Reagents
RPS14 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
456 bp
Description
Full length Clone DNA of Mouse ribosomal protein S14.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS14 cDNA ORF Clone, Mouse, untagged Alternative Names
2600014J02Rik cDNA ORF Clone, Mouse;AL023078 cDNA ORF Clone, Mouse
RPS14 Background Information
Full Name
ribosomal protein S14

RPS14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS14 cDNA ORF Clone in Cloning Vector, Mouse MG51360-U
RPS14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51360-ACGLN
RPS14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51360-ACG
RPS14 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51360-ANG
RPS14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51360-ACR
RPS14 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51360-ANR
RPS14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51360-CF
RPS14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51360-NF
RPS14 cDNA ORF Clone, Mouse, C-His tag MG51360-CH
RPS14 cDNA ORF Clone, Mouse, N-His tag MG51360-NH
RPS14 cDNA ORF Clone, Mouse, C-HA tag MG51360-CY
RPS14 cDNA ORF Clone, Mouse, N-HA tag MG51360-NY
RPS14 cDNA ORF Clone, Mouse, C-Myc tag MG51360-CM
RPS14 cDNA ORF Clone, Mouse, N-Myc tag MG51360-NM
RPS14 qPCR Primer Pairs, Mouse MP201237

RPS14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS14 cDNA ORF Clone in Cloning Vector, Human HG18846-U
RPS14 cDNA ORF Clone, Human, untagged HG18846-UT
RPS14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18846-ACGLN
RPS14 cDNA ORF Clone, Human, C-GFPSpark® tag HG18846-ACG
RPS14 cDNA ORF Clone, Human, N-GFPSpark® tag HG18846-ANG
RPS14 cDNA ORF Clone, Human, C-OFPSpark® tag HG18846-ACR
RPS14 cDNA ORF Clone, Human, N-OFPSpark® tag HG18846-ANR
RPS14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18846-CF
RPS14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18846-NF
RPS14 cDNA ORF Clone, Human, C-His tag HG18846-CH
RPS14 cDNA ORF Clone, Human, N-His tag HG18846-NH
RPS14 cDNA ORF Clone, Human, C-HA tag HG18846-CY
RPS14 cDNA ORF Clone, Human, N-HA tag HG18846-NY
RPS14 cDNA ORF Clone, Human, C-Myc tag HG18846-CM
RPS14 cDNA ORF Clone, Human, N-Myc tag HG18846-NM
info info
添加购物车成功! 添加购物车失败!