RNH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52212-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RNH1 Reagents
CRO Services
Product recommended

All RNH1 Reagents
RNH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1371 bp
Description
Full length Clone DNA of Mouse ribonuclease/angiogenin inhibitor 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
AW546468 cDNA ORF Clone, Mouse;C80305 cDNA ORF Clone, Mouse;RNH cDNA ORF Clone, Mouse
RNH1 Background Information
Full Name
ribonuclease/angiogenin inhibitor 1

RNH1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RNH1 cDNA ORF Clone in Cloning Vector, Rat RG86126-U
RNH1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86126-ACGLN

RNH1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNH1 cDNA ORF Clone in Cloning Vector, Mouse MG52212-G
RNH1 cDNA ORF Clone, Mouse, untagged MG52212-UT
RNH1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52212-ACGLN
RNH1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52212-ACG
RNH1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52212-ANG
RNH1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52212-ACR
RNH1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52212-ANR
RNH1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52212-NF
RNH1 cDNA ORF Clone, Mouse, C-His tag MG52212-CH
RNH1 cDNA ORF Clone, Mouse, N-His tag MG52212-NH
RNH1 cDNA ORF Clone, Mouse, C-HA tag MG52212-CY
RNH1 cDNA ORF Clone, Mouse, N-HA tag MG52212-NY
RNH1 cDNA ORF Clone, Mouse, C-Myc tag MG52212-CM
RNH1 cDNA ORF Clone, Mouse, N-Myc tag MG52212-NM
RNH1 qPCR Primer Pairs, Mouse MP202085

RNH1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNH1 cDNA ORF Clone in Cloning Vector, Human HG14075-G
RNH1 cDNA ORF Clone, Human, untagged HG14075-UT
RNH1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14075-ACGLN
RNH1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14075-ACG
RNH1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14075-ANG
RNH1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14075-ACR
RNH1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14075-ANR
RNH1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14075-CF
RNH1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14075-NF
RNH1 cDNA ORF Clone, Human, C-His tag HG14075-CH
RNH1 cDNA ORF Clone, Human, N-His tag HG14075-NH
RNH1 cDNA ORF Clone, Human, C-HA tag HG14075-CY
RNH1 cDNA ORF Clone, Human, N-HA tag HG14075-NY
RNH1 cDNA ORF Clone, Human, C-Myc tag HG14075-CM
RNH1 cDNA ORF Clone, Human, N-Myc tag HG14075-NM
RNH1 qPCR Primer Pairs, Human HP102729
info info
添加购物车成功! 添加购物车失败!