RMND5B cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51634-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RMND5B Reagents
CRO Services
Product recommended

All RMND5B Reagents
RMND5B cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1182 bp
Description
Full length Clone DNA of Mouse required for meiotic nuclear division 5 homolog B (S. cerevisiae) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RMND5B cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
0610039K22Rik cDNA ORF Clone, Mouse;Gid2 cDNA ORF Clone, Mouse
RMND5B Background Information
Full Name
required for meiotic nuclear division 5 homolog B (S. cerevisiae)

RMND5B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RMND5B cDNA ORF Clone in Cloning Vector, Mouse MG51634-U
RMND5B cDNA ORF Clone, Mouse, untagged MG51634-UT
RMND5B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51634-ACGLN
RMND5B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51634-ACG
RMND5B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51634-ANG
RMND5B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51634-ACR
RMND5B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51634-ANR
RMND5B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51634-CF
RMND5B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51634-NF
RMND5B cDNA ORF Clone, Mouse, C-His tag MG51634-CH
RMND5B cDNA ORF Clone, Mouse, N-His tag MG51634-NH
RMND5B cDNA ORF Clone, Mouse, C-HA tag MG51634-CY
RMND5B cDNA ORF Clone, Mouse, N-HA tag MG51634-NY
RMND5B cDNA ORF Clone, Mouse, N-Myc tag MG51634-NM
RMND5B qPCR Primer Pairs, Mouse MP201507

RMND5B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RMND5B cDNA ORF Clone in Cloning Vector, Human HG26420-U
RMND5B cDNA ORF Clone, Human, untagged HG26420-UT
RMND5B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG26420-ACGLN
RMND5B cDNA ORF Clone, Human, C-GFPSpark® tag HG26420-ACG
RMND5B cDNA ORF Clone, Human, N-GFPSpark® tag HG26420-ANG
RMND5B cDNA ORF Clone, Human, C-OFPSpark® tag HG26420-ACR
RMND5B cDNA ORF Clone, Human, N-OFPSpark® tag HG26420-ANR
RMND5B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG26420-CF
RMND5B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG26420-NF
RMND5B cDNA ORF Clone, Human, C-His tag HG26420-CH
RMND5B cDNA ORF Clone, Human, N-His tag HG26420-NH
RMND5B cDNA ORF Clone, Human, C-HA tag HG26420-CY
RMND5B cDNA ORF Clone, Human, N-HA tag HG26420-NY
RMND5B cDNA ORF Clone, Human, C-Myc tag HG26420-CM
RMND5B cDNA ORF Clone, Human, N-Myc tag HG26420-NM
info info
添加购物车成功! 添加购物车失败!