RhoA cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52590-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RhoA Reagents
CRO Services
Product recommended

All RhoA Reagents
RhoA cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
582 bp
Description
Full length Clone DNA of Mouse ras homolog gene family, member A with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RhoA cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Arha cDNA ORF Clone, Mouse;Arha1 cDNA ORF Clone, Mouse;Arha2 cDNA ORF Clone, Mouse
RhoA Background Information

Transforming protein RhoA, also known as Rho cDNA clone 12, Ras homolog gene family member A, RHOA and ARH12, is a cell membrane and cytoplasm protein which belongs to the small GTPase superfamily and Rho family. The Rho family of small GTPases plays a key role in the dynamic regulation of the actin cytoskeleton that underlies various important cellular functions such as shape changes, migration, and polarity. RHOA / ARH12 is part of a larger family of related proteins known as the Ras superfamily; proteins involved in the regulation and timing of cell division. RHOA / ARH12 is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 (Rho-associated, coiled-coil containing protein kinase 1) and DIAPH1 ( diaphanous homolog 1 (Drosophila) ). RHOA / ARH12 regulates a signal transduction pathway linking plasma membrane receptors to the assembly of focal adhesions and actin stress fibers. RHOA / ARH12 serves as a target for the yopT cysteine peptidase from Yersinia pestis, vector of the plague, and Yersinia pseudotuberculosis, which causes gastrointestinal disorders. RHOA / ARH12 may be an activator of PLCE1. It is activated by ARHGEF2, which promotes the exchange of GDP for GTP.

Full Name
ras homolog family member A
References
  • Kiss C, et al.,1997, Cytogenet. Cell Genet. 79 (3-4): 228-30.
  • Anastasiadis,P.Z. et al., 2000, Nat Cell Biol. 2 (9):637-44.
  • Yiu G, et al.,2006, Nat. Rev. Neurosci. 7 (8): 617-27.
  • Wang,HR. et al., 2006, Methods Enzymol. 406 :437-47.
  • Heo,J. et al., 2006, Biochemistry. 45 (48):14481-9.
  • RhoA cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    RhoA cDNA ORF Clone in Cloning Vector, Canine DG70174-U
    RhoA cDNA ORF Clone, Canine, untagged DG70174-UT
    RhoA cDNA ORF Clone, Canine, C-GFPSpark® tag DG70174-ACG
    RhoA Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70174-ACGLN
    RhoA cDNA ORF Clone, Canine, N-GFPSpark® tag DG70174-ANG
    RhoA cDNA ORF Clone, Canine, C-OFPSpark® tag DG70174-ACR
    RhoA cDNA ORF Clone, Canine, N-OFPSpark® tag DG70174-ANR
    RhoA cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70174-CF
    RhoA cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70174-NF
    RhoA cDNA ORF Clone, Canine, C-His tag DG70174-CH
    RhoA cDNA ORF Clone, Canine, N-His tag DG70174-NH
    RhoA cDNA ORF Clone, Canine, C-HA tag DG70174-CY
    RhoA cDNA ORF Clone, Canine, N-HA tag DG70174-NY
    RhoA cDNA ORF Clone, Canine, C-Myc tag DG70174-CM
    RhoA cDNA ORF Clone, Canine, N-Myc tag DG70174-NM

    RhoA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    RhoA cDNA ORF Clone in Cloning Vector, Rat RG80547-U
    RhoA cDNA ORF Clone, Rat, untagged RG80547-UT
    RhoA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80547-ACGLN
    RhoA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80547-ACG
    RhoA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80547-ACR
    RhoA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80547-CF
    RhoA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80547-NF
    RhoA cDNA ORF Clone, Rat, C-His tag RG80547-CH
    RhoA cDNA ORF Clone, Rat, N-His tag RG80547-NH
    RhoA cDNA ORF Clone, Rat, C-HA tag RG80547-CY
    RhoA cDNA ORF Clone, Rat, N-HA tag RG80547-NY
    RhoA cDNA ORF Clone, Rat, C-Myc tag RG80547-CM
    RhoA cDNA ORF Clone, Rat, N-Myc tag RG80547-NM
    RhoA qPCR Primer Pairs, Rat RP300511

    RhoA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RhoA cDNA ORF Clone in Cloning Vector, Mouse MG52590-U
    RhoA cDNA ORF Clone, Mouse, untagged MG52590-UT
    RhoA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52590-ACGLN
    RhoA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52590-ACG
    RhoA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52590-ANG
    RhoA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52590-ACR
    RhoA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52590-ANR
    RhoA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52590-CF
    RhoA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52590-NF
    RhoA cDNA ORF Clone, Mouse, C-His tag MG52590-CH
    RhoA cDNA ORF Clone, Mouse, N-His tag MG52590-NH
    RhoA cDNA ORF Clone, Mouse, C-HA tag MG52590-CY
    RhoA cDNA ORF Clone, Mouse, N-HA tag MG52590-NY
    RhoA cDNA ORF Clone, Mouse, C-Myc tag MG52590-CM
    RhoA qPCR Primer Pairs, Mouse MP202461

    RhoA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RhoA cDNA ORF Clone in Cloning Vector, Human HG12110-M
    RhoA cDNA ORF Clone, Human, untagged HG12110-UT
    RhoA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12110-ACGLN
    RhoA cDNA ORF Clone, Human, C-GFPSpark® tag HG12110-ACG
    RhoA cDNA ORF Clone, Human, N-GFPSpark® tag HG12110-ANG
    RhoA cDNA ORF Clone, Human, C-OFPSpark® tag HG12110-ACR
    RhoA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12110-CF
    RhoA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12110-NF
    RhoA cDNA ORF Clone, Human, C-His tag HG12110-CH
    RhoA cDNA ORF Clone, Human, N-His tag HG12110-NH
    RhoA cDNA ORF Clone, Human, C-HA tag HG12110-CY
    RhoA cDNA ORF Clone, Human, N-HA tag HG12110-NY
    RhoA cDNA ORF Clone, Human, C-Myc tag HG12110-CM
    RhoA cDNA ORF Clone, Human, N-Myc tag HG12110-NM
    RhoA qPCR Primer Pairs, Human HP100025
    info info
    添加购物车成功! 添加购物车失败!