RCAN1 cDNA ORF Clone, Mouse, untagged

Cat: MG51377-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RCAN1 Reagents
CRO Services
Product recommended

All RCAN1 Reagents
RCAN1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Mouse regulator of calcineurin 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RCAN1 cDNA ORF Clone, Mouse, untagged Alternative Names
Adapt78 cDNA ORF Clone, Mouse;CALP1L cDNA ORF Clone, Mouse;CSP1 cDNA ORF Clone, Mouse;DSC1 cDNA ORF Clone, Mouse;Dscr1 cDNA ORF Clone, Mouse;MCIP1 cDNA ORF Clone, Mouse;RCN1 cDNA ORF Clone, Mouse
RCAN1 Background Information
Full Name
regulator of calcineurin 1

RCAN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RCAN1 cDNA ORF Clone in Cloning Vector, Mouse MG51377-U
RCAN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51377-ACG
RCAN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51377-ACGLN
RCAN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51377-ANG
RCAN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51377-ACR
RCAN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51377-ANR
RCAN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51377-CF
RCAN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51377-NF
RCAN1 cDNA ORF Clone, Mouse, C-His tag MG51377-CH
RCAN1 cDNA ORF Clone, Mouse, N-His tag MG51377-NH
RCAN1 cDNA ORF Clone, Mouse, C-HA tag MG51377-CY
RCAN1 cDNA ORF Clone, Mouse, N-HA tag MG51377-NY
RCAN1 cDNA ORF Clone, Mouse, C-Myc tag MG51377-CM
RCAN1 cDNA ORF Clone, Mouse, N-Myc tag MG51377-NM
RCAN1 qPCR Primer Pairs, Mouse MP201250

RCAN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RCAN1 cDNA ORF Clone in Cloning Vector, Human HG18177-U
RCAN1 cDNA ORF Clone, Human, untagged HG18177-UT
RCAN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG18177-ACG
RCAN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18177-ACGLN
RCAN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG18177-ANG
RCAN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG18177-ACR
RCAN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG18177-ANR
RCAN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18177-CF
RCAN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18177-NF
RCAN1 cDNA ORF Clone, Human, C-His tag HG18177-CH
RCAN1 cDNA ORF Clone, Human, N-His tag HG18177-NH
RCAN1 cDNA ORF Clone, Human, C-HA tag HG18177-CY
RCAN1 cDNA ORF Clone, Human, N-HA tag HG18177-NY
RCAN1 cDNA ORF Clone, Human, C-Myc tag HG18177-CM
RCAN1 cDNA ORF Clone, Human, N-Myc tag HG18177-NM
info info
添加购物车成功! 添加购物车失败!