RALA cDNA ORF Clone, Mouse, untagged

Cat: MG52476-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RALA Reagents
CRO Services
Product recommended

All RALA Reagents
RALA cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
621 bp
Description
Full length Clone DNA of Mouse v-ral simian leukemia viral oncogene homolog A (ras related).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RALA cDNA ORF Clone, Mouse, untagged Alternative Names
3010001O15Rik cDNA ORF Clone, Mouse;AW322615 cDNA ORF Clone, Mouse;Ral cDNA ORF Clone, Mouse;Rasl1 cDNA ORF Clone, Mouse
RALA Background Information
Full Name
v-ral simian leukemia viral oncogene homolog A (ras related)

RALA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RALA cDNA ORF Clone in Cloning Vector, Rat RG83053-U
RALA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83053-ACGLN

RALA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RALA cDNA ORF Clone in Cloning Vector, Mouse MG52476-G
RALA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52476-ACGLN
RALA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52476-ACG
RALA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52476-ANG
RALA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52476-ACR
RALA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52476-ANR
RALA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52476-CF
RALA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52476-NF
RALA cDNA ORF Clone, Mouse, C-His tag MG52476-CH
RALA cDNA ORF Clone, Mouse, N-His tag MG52476-NH
RALA cDNA ORF Clone, Mouse, C-HA tag MG52476-CY
RALA cDNA ORF Clone, Mouse, N-HA tag MG52476-NY
RALA cDNA ORF Clone, Mouse, C-Myc tag MG52476-CM
RALA cDNA ORF Clone, Mouse, N-Myc tag MG52476-NM
RALA qPCR Primer Pairs, Mouse MP202349

RALA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RALA cDNA ORF Clone in Cloning Vector, Human HG18070-U
RALA cDNA ORF Clone, Human, untagged HG18070-UT
RALA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18070-ACGLN
RALA cDNA ORF Clone, Human, C-GFPSpark® tag HG18070-ACG
RALA cDNA ORF Clone, Human, N-GFPSpark® tag HG18070-ANG
RALA cDNA ORF Clone, Human, C-OFPSpark® tag HG18070-ACR
RALA cDNA ORF Clone, Human, N-OFPSpark® tag HG18070-ANR
RALA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18070-CF
RALA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18070-NF
RALA cDNA ORF Clone, Human, C-His tag HG18070-CH
RALA cDNA ORF Clone, Human, N-His tag HG18070-NH
RALA cDNA ORF Clone, Human, C-HA tag HG18070-CY
RALA cDNA ORF Clone, Human, N-HA tag HG18070-NY
RALA cDNA ORF Clone, Human, C-Myc tag HG18070-CM
RALA cDNA ORF Clone, Human, N-Myc tag HG18070-NM
info info
添加购物车成功! 添加购物车失败!