QDPR cDNA ORF Clone, Mouse, N-His tag

Cat: MG51411-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All QDPR Reagents
CRO Services
Product recommended

All QDPR Reagents
QDPR cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
726 bp
Description
Full length Clone DNA of Mouse quinoid dihydropteridine reductase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

QDPR cDNA ORF Clone, Mouse, N-His tag Alternative Names
2610008L04Rik cDNA ORF Clone, Mouse;D5Ertd371e cDNA ORF Clone, Mouse;Dhpr cDNA ORF Clone, Mouse;PKU2 cDNA ORF Clone, Mouse
QDPR Background Information
Full Name
quinoid dihydropteridine reductase

QDPR cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
QDPR cDNA ORF Clone in Cloning Vector, Rat RG82386-U
QDPR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82386-ACGLN

QDPR cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
QDPR cDNA ORF Clone in Cloning Vector, Mouse MG51411-G
QDPR cDNA ORF Clone, Mouse, untagged MG51411-UT
QDPR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51411-ACGLN
QDPR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51411-ACG
QDPR cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51411-ANG
QDPR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51411-ACR
QDPR cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51411-ANR
QDPR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51411-CF
QDPR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51411-NF
QDPR cDNA ORF Clone, Mouse, C-His tag MG51411-CH
QDPR cDNA ORF Clone, Mouse, C-HA tag MG51411-CY
QDPR cDNA ORF Clone, Mouse, N-HA tag MG51411-NY
QDPR cDNA ORF Clone, Mouse, C-Myc tag MG51411-CM
QDPR cDNA ORF Clone, Mouse, N-Myc tag MG51411-NM
QDPR qPCR Primer Pairs, Mouse MP201295

QDPR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
QDPR cDNA ORF Clone in Cloning Vector, Human HG18872-U
QDPR cDNA ORF Clone, Human, untagged HG18872-UT
QDPR cDNA ORF Clone, Human, C-GFPSpark® tag HG18872-ACG
QDPR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18872-ACGLN
QDPR cDNA ORF Clone, Human, N-GFPSpark® tag HG18872-ANG
QDPR cDNA ORF Clone, Human, C-OFPSpark® tag HG18872-ACR
QDPR cDNA ORF Clone, Human, N-OFPSpark® tag HG18872-ANR
QDPR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18872-CF
QDPR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18872-NF
QDPR cDNA ORF Clone, Human, C-His tag HG18872-CH
QDPR cDNA ORF Clone, Human, N-His tag HG18872-NH
QDPR cDNA ORF Clone, Human, C-HA tag HG18872-CY
QDPR cDNA ORF Clone, Human, N-HA tag HG18872-NY
QDPR cDNA ORF Clone, Human, C-Myc tag HG18872-CM
QDPR cDNA ORF Clone, Human, N-Myc tag HG18872-NM
info info
添加购物车成功! 添加购物车失败!