PTMA cDNA ORF Clone, Mouse, untagged

Cat: MG50272-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PTMA Reagents
CRO Services
Product recommended

All PTMA Reagents
PTMA cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
336 bp
Description
Full length Clone DNA of Mouse prothymosin alpha.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PTMA cDNA ORF Clone, Mouse, untagged Alternative Names
Thym cDNA ORF Clone, Mouse
PTMA Background Information

PTMA (prothymosin, alpha, N-GST chimera) is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin a1. Thymosins are named becaues they were originally isolated from the thymus. But now in many other tissues, thymosins also can be detected. Thymosins have diverse biological activities, and two in particular, thymosins a1 and _4, have potentially important uses in medicine, some of which have already progressed from the laboratory to the clinic. In general, PTMA is associated with cellular proliferation and carcinogenesis (Eschenfeldt et al., 1986), cellular and viral transcription (Cotter et al., 2000), protection against apoptosis and chromatin remodelling (Karetsou et al., 1998). PTMA may have a dual role both intracellulary and extracellulary. In relation to diseases, thymosins have been categorized as biological response modifiers. Thymosin a1 is derived from PTMA. For animals that lack thymus glands, thymosin a1 is responsible for the activity of that preparation in restoring immune function.

Full Name
prothymosin, alpha
References
  • Manrow RE, et al. (1992) The human prothymosin alpha gene family contains several processed pseudogenes lacking deleterious lesions. Genomics. 13(2):319-31.
  • Wara DW, et al. (1975) Thymosin activity in patients with cellular immunodeficiency. N Engl J Med. 292(2):70-4.
  • Garaci E, et al. (2007) Thymosin alpha 1: from bench to bedside. Ann N Y Acad Sci. 1112:225-34.
  • Goldstein AL, et al. (2009) From lab to bedside: emerging clinical applications of thymosin alpha 1. Expert Opin Biol Ther. 9(5):593-608.
  • PTMA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PTMA cDNA ORF Clone in Cloning Vector, Rat RG81172-U
    PTMA cDNA ORF Clone, Rat, untagged RG81172-UT
    PTMA cDNA ORF Clone, Rat, C-GFPSpark® tag RG81172-ACG
    PTMA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81172-ACGLN
    PTMA cDNA ORF Clone, Rat, N-GFPSpark® tag RG81172-ANG
    PTMA cDNA ORF Clone, Rat, C-OFPSpark® tag RG81172-ACR
    PTMA cDNA ORF Clone, Rat, N-OFPSpark® tag RG81172-ANR
    PTMA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81172-CF
    PTMA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81172-NF
    PTMA cDNA ORF Clone, Rat, C-His tag RG81172-CH
    PTMA cDNA ORF Clone, Rat, N-His tag RG81172-NH
    PTMA cDNA ORF Clone, Rat, C-HA tag RG81172-CY
    PTMA cDNA ORF Clone, Rat, N-HA tag RG81172-NY
    PTMA cDNA ORF Clone, Rat, C-Myc tag RG81172-CM
    PTMA cDNA ORF Clone, Rat, N-Myc tag RG81172-NM
    PTMA qPCR Primer Pairs, Rat RP301128

    PTMA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PTMA cDNA ORF Clone in Cloning Vector, Mouse MG50272-M
    PTMA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50272-ACG
    PTMA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50272-ACGLN
    PTMA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50272-ANG
    PTMA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50272-ACR
    PTMA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50272-ANR
    PTMA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50272-CF
    PTMA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50272-NF
    PTMA cDNA ORF Clone, Mouse, C-His tag MG50272-CH
    PTMA cDNA ORF Clone, Mouse, N-His tag MG50272-NH
    PTMA cDNA ORF Clone, Mouse, C-HA tag MG50272-CY
    PTMA cDNA ORF Clone, Mouse, N-HA tag MG50272-NY
    PTMA cDNA ORF Clone, Mouse, C-Myc tag MG50272-CM
    PTMA cDNA ORF Clone, Mouse, N-Myc tag MG50272-NM
    PTMA qPCR Primer Pairs, Mouse MP200296

    PTMA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PTMA cDNA ORF Clone in Cloning Vector, Human HG11407-M
    PTMA cDNA ORF Clone, Human, untagged HG11407-UT
    PTMA cDNA ORF Clone, Human, C-GFPSpark® tag HG11407-ACG
    PTMA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11407-ACGLN
    PTMA cDNA ORF Clone, Human, N-GFPSpark® tag HG11407-ANG
    PTMA cDNA ORF Clone, Human, C-OFPSpark® tag HG11407-ACR
    PTMA cDNA ORF Clone, Human, N-OFPSpark® tag HG11407-ANR
    PTMA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11407-CF
    PTMA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11407-NF
    PTMA cDNA ORF Clone, Human, C-His tag HG11407-CH
    PTMA cDNA ORF Clone, Human, N-His tag HG11407-NH
    PTMA cDNA ORF Clone, Human, C-HA tag HG11407-CY
    PTMA cDNA ORF Clone, Human, N-HA tag HG11407-NY
    PTMA cDNA ORF Clone, Human, C-Myc tag HG11407-CM
    PTMA cDNA ORF Clone, Human, N-Myc tag HG11407-NM
    PTMA qPCR Primer Pairs, Human HP101285
    info info
    添加购物车成功! 添加购物车失败!