PSMD6 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52749-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMD6 Reagents
CRO Services
Product recommended

All PSMD6 Reagents
PSMD6 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1170 bp
Description
Full length Clone DNA of Mouse proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMD6 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2400006A19Rik cDNA ORF Clone, Mouse
PSMD6 Background Information
Full Name
proteasome 26S subunit, non-ATPase 6

PSMD6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMD6 cDNA ORF Clone in Cloning Vector, Rat RG8A1870-U
PSMD6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1870-ACGLN

PSMD6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMD6 cDNA ORF Clone in Cloning Vector, Mouse MG52749-G
PSMD6 cDNA ORF Clone, Mouse, untagged MG52749-UT
PSMD6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52749-ACGLN
PSMD6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52749-ACG
PSMD6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52749-ANG
PSMD6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52749-ACR
PSMD6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52749-ANR
PSMD6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52749-CF
PSMD6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52749-NF
PSMD6 cDNA ORF Clone, Mouse, C-His tag MG52749-CH
PSMD6 cDNA ORF Clone, Mouse, N-His tag MG52749-NH
PSMD6 cDNA ORF Clone, Mouse, C-HA tag MG52749-CY
PSMD6 cDNA ORF Clone, Mouse, N-HA tag MG52749-NY
PSMD6 cDNA ORF Clone, Mouse, N-Myc tag MG52749-NM

PSMD6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMD6 cDNA ORF Clone in Cloning Vector, Human HG16515-G
PSMD6 cDNA ORF Clone, Human, untagged HG16515-UT
PSMD6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16515-ACG
PSMD6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16515-ACGLN
PSMD6 cDNA ORF Clone, Human, N-GFPSpark® tag HG16515-ANG
PSMD6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16515-ACR
PSMD6 cDNA ORF Clone, Human, N-OFPSpark® tag HG16515-ANR
PSMD6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16515-CF
PSMD6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16515-NF
PSMD6 cDNA ORF Clone, Human, C-His tag HG16515-CH
PSMD6 cDNA ORF Clone, Human, N-His tag HG16515-NH
PSMD6 cDNA ORF Clone, Human, C-HA tag HG16515-CY
PSMD6 cDNA ORF Clone, Human, N-HA tag HG16515-NY
PSMD6 cDNA ORF Clone, Human, C-Myc tag HG16515-CM
PSMD6 cDNA ORF Clone, Human, N-Myc tag HG16515-NM
info info
添加购物车成功! 添加购物车失败!