PSKH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51032-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSKH1 Reagents
CRO Services
Product recommended

All PSKH1 Reagents
PSKH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Mouse protein serine kinase H1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSKH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
AW539964 cDNA ORF Clone, Mouse;b2b1230Clo cDNA ORF Clone, Mouse;E130013P03Rik cDNA ORF Clone, Mouse
PSKH1 Background Information
Full Name
protein serine kinase H1

PSKH1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSKH1 cDNA ORF Clone in Cloning Vector, Mouse MG51032-G
PSKH1 cDNA ORF Clone, Mouse, untagged MG51032-UT
PSKH1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51032-ACGLN
PSKH1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51032-ACG
PSKH1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51032-ANG
PSKH1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51032-ACR
PSKH1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51032-ANR
PSKH1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51032-NF
PSKH1 cDNA ORF Clone, Mouse, C-His tag MG51032-CH
PSKH1 cDNA ORF Clone, Mouse, N-His tag MG51032-NH
PSKH1 cDNA ORF Clone, Mouse, C-HA tag MG51032-CY
PSKH1 cDNA ORF Clone, Mouse, N-HA tag MG51032-NY
PSKH1 cDNA ORF Clone, Mouse, C-Myc tag MG51032-CM
PSKH1 cDNA ORF Clone, Mouse, N-Myc tag MG51032-NM
PSKH1 qPCR Primer Pairs, Mouse MP200991

PSKH1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSKH1 cDNA ORF Clone in Cloning Vector, Human HG10766-M
PSKH1 cDNA ORF Clone, Human, untagged HG10766-UT
PSKH1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10766-ACG
PSKH1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10766-ACGLN
PSKH1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10766-ANG
PSKH1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10766-ACR
PSKH1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10766-ANR
PSKH1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10766-CF
PSKH1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10766-NF
PSKH1 cDNA ORF Clone, Human, C-His tag HG10766-CH
PSKH1 cDNA ORF Clone, Human, N-His tag HG10766-NH
PSKH1 cDNA ORF Clone, Human, C-HA tag HG10766-CY
PSKH1 cDNA ORF Clone, Human, N-HA tag HG10766-NY
PSKH1 cDNA ORF Clone, Human, C-Myc tag HG10766-CM
PSKH1 cDNA ORF Clone, Human, N-Myc tag HG10766-NM
PSKH1 qPCR Primer Pairs, Human HP100688
info info
添加购物车成功! 添加购物车失败!