PRP19 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51465-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRP19 Reagents
CRO Services
Product recommended

All PRP19 Reagents
PRP19 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1515 bp
Description
Full length Clone DNA of Mouse PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRP19 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AA617263 cDNA ORF Clone, Mouse;AL024362 cDNA ORF Clone, Mouse;D19Wsu55e cDNA ORF Clone, Mouse;NMP200 cDNA ORF Clone, Mouse;Prp19 cDNA ORF Clone, Mouse;PSO4 cDNA ORF Clone, Mouse;Snev cDNA ORF Clone, Mouse
PRP19 Background Information
Full Name
pre-mRNA processing factor 19

PRP19 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PRP19 cDNA ORF Clone in Cloning Vector, Rat RG81400-G

PRP19 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRP19 cDNA ORF Clone in Cloning Vector, Mouse MG51465-G
PRP19 cDNA ORF Clone, Mouse, untagged MG51465-UT
PRP19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51465-ACGLN
PRP19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51465-ACG
PRP19 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51465-ANG
PRP19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51465-ACR
PRP19 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51465-ANR
PRP19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51465-CF
PRP19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51465-NF
PRP19 cDNA ORF Clone, Mouse, C-His tag MG51465-CH
PRP19 cDNA ORF Clone, Mouse, N-His tag MG51465-NH
PRP19 cDNA ORF Clone, Mouse, C-HA tag MG51465-CY
PRP19 cDNA ORF Clone, Mouse, N-HA tag MG51465-NY
PRP19 cDNA ORF Clone, Mouse, C-Myc tag MG51465-CM
PRP19 qPCR Primer Pairs, Mouse MP201349

PRP19 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRP19 cDNA ORF Clone in Cloning Vector, Human HG14996-G
PRP19 cDNA ORF Clone, Human, untagged HG14996-UT
PRP19 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14996-ACGLN
PRP19 cDNA ORF Clone, Human, C-GFPSpark® tag HG14996-ACG
PRP19 cDNA ORF Clone, Human, N-GFPSpark® tag HG14996-ANG
PRP19 cDNA ORF Clone, Human, C-OFPSpark® tag HG14996-ACR
PRP19 cDNA ORF Clone, Human, N-OFPSpark® tag HG14996-ANR
PRP19 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14996-CF
PRP19 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14996-NF
PRP19 cDNA ORF Clone, Human, C-His tag HG14996-CH
PRP19 cDNA ORF Clone, Human, N-His tag HG14996-NH
PRP19 cDNA ORF Clone, Human, C-HA tag HG14996-CY
PRP19 cDNA ORF Clone, Human, N-HA tag HG14996-NY
PRP19 cDNA ORF Clone, Human, C-Myc tag HG14996-CM
PRP19 cDNA ORF Clone, Human, N-Myc tag HG14996-NM
PRP19 qPCR Primer Pairs, Human HP103624
info info
添加购物车成功! 添加购物车失败!