POLR2G cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52731-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All POLR2G Reagents
CRO Services
Product recommended

All POLR2G Reagents
POLR2G cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
519 bp
Description
Full length Clone DNA of Mouse polymerase (RNA) II (DNA directed) polypeptide G with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

POLR2G cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2410046K11Rik cDNA ORF Clone, Mouse;A230108L04Rik cDNA ORF Clone, Mouse;C76415 cDNA ORF Clone, Mouse;RBP7 cDNA ORF Clone, Mouse;Rpo2-7l cDNA ORF Clone, Mouse
POLR2G Background Information
Full Name
polymerase (RNA) II (DNA directed) polypeptide G

POLR2G cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
POLR2G cDNA ORF Clone in Cloning Vector, Mouse MG52731-G
POLR2G cDNA ORF Clone, Mouse, untagged MG52731-UT
POLR2G Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52731-ACGLN
POLR2G cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52731-ACG
POLR2G cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52731-ANG
POLR2G cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52731-ACR
POLR2G cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52731-ANR
POLR2G cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52731-CF
POLR2G cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52731-NF
POLR2G cDNA ORF Clone, Mouse, C-His tag MG52731-CH
POLR2G cDNA ORF Clone, Mouse, N-His tag MG52731-NH
POLR2G cDNA ORF Clone, Mouse, C-HA tag MG52731-CY
POLR2G cDNA ORF Clone, Mouse, N-HA tag MG52731-NY
POLR2G cDNA ORF Clone, Mouse, N-Myc tag MG52731-NM
POLR2G qPCR Primer Pairs, Mouse MP202602

POLR2G cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
POLR2G cDNA ORF Clone in Cloning Vector, Human HG18510-U
POLR2G cDNA ORF Clone, Human, untagged HG18510-UT
POLR2G cDNA ORF Clone, Human, C-GFPSpark® tag HG18510-ACG
POLR2G Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18510-ACGLN
POLR2G cDNA ORF Clone, Human, N-GFPSpark® tag HG18510-ANG
POLR2G cDNA ORF Clone, Human, C-OFPSpark® tag HG18510-ACR
POLR2G cDNA ORF Clone, Human, N-OFPSpark® tag HG18510-ANR
POLR2G cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18510-CF
POLR2G cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18510-NF
POLR2G cDNA ORF Clone, Human, C-His tag HG18510-CH
POLR2G cDNA ORF Clone, Human, N-His tag HG18510-NH
POLR2G cDNA ORF Clone, Human, C-HA tag HG18510-CY
POLR2G cDNA ORF Clone, Human, N-HA tag HG18510-NY
POLR2G cDNA ORF Clone, Human, C-Myc tag HG18510-CM
POLR2G cDNA ORF Clone, Human, N-Myc tag HG18510-NM
info info
添加购物车成功! 添加购物车失败!