PIM2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52013-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PIM2 Reagents
CRO Services
Product recommended

All PIM2 Reagents
PIM2 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1113 bp
Description
Full length Clone DNA of Mouse proviral integration site 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PIM2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
DXCch3 cDNA ORF Clone, Mouse;Pim-2 cDNA ORF Clone, Mouse
PIM2 Background Information
Full Name
Pim-2 proto-oncogene, serine/threonine kinase

PIM2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PIM2 cDNA ORF Clone in Cloning Vector, Mouse MG52013-G
PIM2 cDNA ORF Clone, Mouse, untagged MG52013-UT
PIM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52013-ACG
PIM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52013-ACGLN
PIM2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52013-ANG
PIM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52013-ACR
PIM2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52013-ANR
PIM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52013-CF
PIM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52013-NF
PIM2 cDNA ORF Clone, Mouse, C-His tag MG52013-CH
PIM2 cDNA ORF Clone, Mouse, N-His tag MG52013-NH
PIM2 cDNA ORF Clone, Mouse, C-HA tag MG52013-CY
PIM2 cDNA ORF Clone, Mouse, N-HA tag MG52013-NY
PIM2 cDNA ORF Clone, Mouse, C-Myc tag MG52013-CM
PIM2 qPCR Primer Pairs, Mouse MP201886

PIM2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PIM2 cDNA ORF Clone in Cloning Vector, Human HG11560-M
PIM2 cDNA ORF Clone, Human, untagged HG11560-UT
PIM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11560-ACGLN
PIM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11560-ACG
PIM2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11560-ANG
PIM2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11560-ACR
PIM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11560-CF
PIM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11560-NF
PIM2 cDNA ORF Clone, Human, C-His tag HG11560-CH
PIM2 cDNA ORF Clone, Human, N-His tag HG11560-NH
PIM2 cDNA ORF Clone, Human, C-HA tag HG11560-CY
PIM2 cDNA ORF Clone, Human, N-HA tag HG11560-NY
PIM2 cDNA ORF Clone, Human, C-Myc tag HG11560-CM
PIM2 cDNA ORF Clone, Human, N-Myc tag HG11560-NM
PIM2 qPCR Primer Pairs, Human HP101425
info info
添加购物车成功! 添加购物车失败!