PDGF-C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50458-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDGF-C Reagents
CRO Services
Product recommended

All PDGF-C Reagents
PDGF-C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1038 bp
Description
Full length Clone DNA of Mouse platelet-derived growth factor, C polypeptide with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDGF-C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
1110064L01Rik cDNA ORF Clone, Mouse;AI647969 cDNA ORF Clone, Mouse;PDGF-C cDNA ORF Clone, Mouse
PDGF-C Background Information

PDGF-C is a member of the PDGF/VEGF family of growth factors with a unique domain organization and expression pattern. Platelet-derived growth factor receptors (PDGFRs) are catalytic receptors that have intracellular tyrosine kinase activity. They have roles in the regulation of many biological processes including embryonic development, angiogenesis, cell proliferation and differentiation, and contribute to the pathophysiology of some diseases, including cancer. There are two isoforms of the PDGFR receptor; PDGFRalpha and PDGFRbeta, which can form homo- or heterodimers. The endogenous PDGFR ligands are PDGF-A, -B, -C and -D, which induce receptor dimerization and transphosphorylation at specific tyrosine residues upon binding. This activates the intracellular kinase activity, initiating intracellular signaling through the MAPK, PI 3-K and PKCgamma pathways. PDGF-C acts as a specific ligand for alpha platelet-derived growth factor receptor homodimer, and alpha and beta heterodimer. Binding of this growth factor to its affinity receptor elicits a variety of cellular responses. PDGF-C Appears to be involved in the three stages of wound healing: inflammation, proliferation and remodeling. Involved in fibrotic processes, in which transformation of interstitial fibroblasts into myofibroblasts plus collagen deposition occurs.

Full Name
platelet derived growth factor C
References
  • Li X, et al. (2000) PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol. 2 (5): 302-9.
  • Ding H, et al. (2004) A specific requirement for PDGF-C in palate formation and PDGFR-alpha signaling. Nat Genet. 36 (10): 1111-6.
  • Choi SJ, et al. (2009) The PDGF-C regulatory region SNP rs28999109 decreases promoter transcriptional activity and is associated with CL/P. European Journal of Human Genetics. 17 (11): 774-84.
  • PDGF-C cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    PDGF-C cDNA ORF Clone in Cloning Vector, Rhesus CG90031-G
    PDGF-C cDNA ORF Clone, Rhesus, untagged CG90031-UT
    PDGF-C cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90031-ACG
    PDGF-C Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90031-ACGLN
    PDGF-C cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90031-ACR
    PDGF-C cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90031-CF
    PDGF-C cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90031-NF
    PDGF-C cDNA ORF Clone, Rhesus, C-His tag CG90031-CH
    PDGF-C cDNA ORF Clone, Rhesus, N-His tag CG90031-NH
    PDGF-C cDNA ORF Clone, Rhesus, C-HA tag CG90031-CY
    PDGF-C cDNA ORF Clone, Rhesus, N-HA tag CG90031-NY
    PDGF-C cDNA ORF Clone, Rhesus, C-Myc tag CG90031-CM
    PDGF-C cDNA ORF Clone, Rhesus, N-Myc tag CG90031-NM

    PDGF-C cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PDGF-C cDNA ORF Clone in Cloning Vector, Mouse MG50458-M
    PDGF-C cDNA ORF Clone, Mouse, untagged MG50458-UT
    PDGF-C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50458-ACGLN
    PDGF-C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50458-ACG
    PDGF-C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50458-ACR
    PDGF-C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50458-CF
    PDGF-C cDNA ORF Clone, Mouse, C-His tag MG50458-CH
    PDGF-C cDNA ORF Clone, Mouse, N-His tag MG50458-NH
    PDGF-C cDNA ORF Clone, Mouse, C-HA tag MG50458-CY
    PDGF-C cDNA ORF Clone, Mouse, N-HA tag MG50458-NY
    PDGF-C cDNA ORF Clone, Mouse, C-Myc tag MG50458-CM
    PDGF-C cDNA ORF Clone, Mouse, N-Myc tag MG50458-NM
    PDGF-C qPCR Primer Pairs, Mouse MP200462

    PDGF-C cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PDGF-C cDNA ORF Clone in Cloning Vector, Human HG10273-M
    PDGF-C cDNA ORF Clone, Human, untagged HG10273-UT
    PDGF-C cDNA ORF Clone, Human, C-GFPSpark® tag HG10273-ACG
    PDGF-C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10273-ACGLN
    PDGF-C cDNA ORF Clone, Human, N-GFPSpark® tag HG10273-ANG
    PDGF-C cDNA ORF Clone, Human, C-OFPSpark® tag HG10273-ACR
    PDGF-C cDNA ORF Clone, Human, N-OFPSpark® tag HG10273-ANR
    PDGF-C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10273-CF
    PDGF-C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10273-NF
    PDGF-C cDNA ORF Clone, Human, C-His tag HG10273-CH
    PDGF-C cDNA ORF Clone, Human, N-His tag HG10273-NH
    PDGF-C cDNA ORF Clone, Human, C-HA tag HG10273-CY
    PDGF-C cDNA ORF Clone, Human, N-HA tag HG10273-NY
    PDGF-C cDNA ORF Clone, Human, C-Myc tag HG10273-CM
    PDGF-C cDNA ORF Clone, Human, N-Myc tag HG10273-NM
    PDGF-C qPCR Primer Pairs, Human HP100320
    info info
    添加购物车成功! 添加购物车失败!