PDE4B cDNA ORF Clone, Mouse, N-His tag

Cat: MG51965-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PDE4B Reagents
CRO Services
Product recommended

All PDE4B Reagents
PDE4B cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1695 bp
Description
Full length Clone DNA of Mouse phosphodiesterase 4B, cAMP specific with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDE4B cDNA ORF Clone, Mouse, N-His tag Alternative Names
Dpde4 cDNA ORF Clone, Mouse;dunce cDNA ORF Clone, Mouse;R74983 cDNA ORF Clone, Mouse
PDE4B Background Information

cAMP-specific 3',5'-cyclic phosphodiesterase 4B, also known as PDE4B and DPDE4, is a member of the cyclic nucleotide phosphodiesterase family. PDE4 subfamily. Cyclic nucleotide phosphodiesterases (PDEs) comprise a large family of enzymes that catalyze the hydrolysis of cAMP or cGMP and are implicated in various diseases. The crystal structures reveal a common scheme of inhibitor binding to the PDEs: (i) a hydrophobic clamp formed by highly conserved hydrophobic residues that sandwich the inhibitor in the active site; (ii) hydrogen bonding to an invariant glutamine that controls the orientation of inhibitor binding. A scaffold can be readily identified for any given inhibitor based on the formation of these two types of conserved interactions. These structural insights will enable the design of isoform-selective inhibitors with improved binding affinity and should facilitate the discovery of more potent and selective PDE inhibitors for the treatment of a variety of diseases. PDE4B / DPDE4 hydrolyzes the second messenger cAMP, which is a key regulator of many important physiological processes. It is expressed in brain, heart, lung and skeletal muscle. PDE4B / DPDE4 may be involved in mediating central nervous system effects of therapeutic agents ranging from antidepressants to antiasthmatic and anti-inflammatory agents

Full Name
phosphodiesterase 4B, cAMP-specific
References
  • Bolger G.et al., 1993, Mol. Cell. Biol. 13:6558-71.
  • Card G.L.et al., 2004, Structure 12:2233-47.
  • Card G.L.et al., 2005, Nat. Biotechnol. 23:201-7.
  • Wang H.et al., 2007, Biochem. J. 408:193-201.
  • Hamblin J.N. et al., 2008, Bioorg. Med. Chem. Lett. 18: 4237-41. 
  • PDE4B cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PDE4B cDNA ORF Clone in Cloning Vector, Rat RG82478-U
    PDE4B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82478-ACGLN

    PDE4B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PDE4B cDNA ORF Clone in Cloning Vector, Mouse MG51965-U
    PDE4B cDNA ORF Clone, Mouse, untagged MG51965-UT
    PDE4B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51965-ACGLN
    PDE4B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51965-ACG
    PDE4B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51965-ANG
    PDE4B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51965-ACR
    PDE4B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51965-ANR
    PDE4B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51965-CF
    PDE4B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51965-NF
    PDE4B cDNA ORF Clone, Mouse, C-His tag MG51965-CH
    PDE4B cDNA ORF Clone, Mouse, C-HA tag MG51965-CY
    PDE4B cDNA ORF Clone, Mouse, N-HA tag MG51965-NY
    PDE4B cDNA ORF Clone, Mouse, C-Myc tag MG51965-CM
    PDE4B cDNA ORF Clone, Mouse, N-Myc tag MG51965-NM
    PDE4B qPCR Primer Pairs, Mouse MP201838

    PDE4B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PDE4B cDNA ORF Clone in Cloning Vector, Human HG11527-M
    PDE4B cDNA ORF Clone, Human, untagged HG11527-UT
    PDE4B cDNA ORF Clone, Human, C-GFPSpark® tag HG11527-ACG
    PDE4B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11527-ACGLN
    PDE4B cDNA ORF Clone, Human, N-GFPSpark® tag HG11527-ANG
    PDE4B cDNA ORF Clone, Human, C-OFPSpark® tag HG11527-ACR
    PDE4B cDNA ORF Clone, Human, N-OFPSpark® tag HG11527-ANR
    PDE4B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11527-CF
    PDE4B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11527-NF
    PDE4B cDNA ORF Clone, Human, C-His tag HG11527-CH
    PDE4B cDNA ORF Clone, Human, N-His tag HG11527-NH
    PDE4B cDNA ORF Clone, Human, C-HA tag HG11527-CY
    PDE4B cDNA ORF Clone, Human, N-HA tag HG11527-NY
    PDE4B cDNA ORF Clone, Human, C-Myc tag HG11527-CM
    PDE4B cDNA ORF Clone, Human, N-Myc tag HG11527-NM
    PDE4B qPCR Primer Pairs, Human HP101397
    info info
    添加购物车成功! 添加购物车失败!