NSA2/TINP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52791-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NSA2/TINP1 Reagents
CRO Services
Product recommended

All NSA2/TINP1 Reagents
NSA2/TINP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
783 bp
Description
Full length Clone DNA of Mouse NSA2 ribosome biogenesis homolog (S. cerevisiae) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NSA2/TINP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
5730427N09Rik cDNA ORF Clone, Mouse;LNR42 cDNA ORF Clone, Mouse;Nsa2p cDNA ORF Clone, Mouse;Tinp1 cDNA ORF Clone, Mouse;Yr29 cDNA ORF Clone, Mouse
NSA2/TINP1 Background Information
Full Name
NSA2 ribosome biogenesis homolog (S. cerevisiae)

NSA2/TINP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NSA2/TINP1 cDNA ORF Clone in Cloning Vector, Rat RG85811-U
NSA2/TINP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85811-ACGLN

NSA2/TINP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NSA2/TINP1 cDNA ORF Clone in Cloning Vector, Mouse MG52791-G
NSA2/TINP1 cDNA ORF Clone, Mouse, untagged MG52791-UT
NSA2/TINP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52791-ACGLN
NSA2/TINP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52791-ACG
NSA2/TINP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52791-ANG
NSA2/TINP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52791-ACR
NSA2/TINP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52791-ANR
NSA2/TINP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52791-NF
NSA2/TINP1 cDNA ORF Clone, Mouse, C-His tag MG52791-CH
NSA2/TINP1 cDNA ORF Clone, Mouse, N-His tag MG52791-NH
NSA2/TINP1 cDNA ORF Clone, Mouse, C-HA tag MG52791-CY
NSA2/TINP1 cDNA ORF Clone, Mouse, N-HA tag MG52791-NY
NSA2/TINP1 cDNA ORF Clone, Mouse, C-Myc tag MG52791-CM
NSA2/TINP1 cDNA ORF Clone, Mouse, N-Myc tag MG52791-NM

NSA2/TINP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NSA2/TINP1 cDNA ORF Clone in Cloning Vector, Human HG17168-U
NSA2/TINP1 cDNA ORF Clone, Human, untagged HG17168-UT
NSA2/TINP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17168-ACGLN
NSA2/TINP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17168-ACG
NSA2/TINP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17168-ANG
NSA2/TINP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17168-ACR
NSA2/TINP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17168-ANR
NSA2/TINP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17168-CF
NSA2/TINP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17168-NF
NSA2/TINP1 cDNA ORF Clone, Human, C-His tag HG17168-CH
NSA2/TINP1 cDNA ORF Clone, Human, N-His tag HG17168-NH
NSA2/TINP1 cDNA ORF Clone, Human, C-HA tag HG17168-CY
NSA2/TINP1 cDNA ORF Clone, Human, N-HA tag HG17168-NY
NSA2/TINP1 cDNA ORF Clone, Human, C-Myc tag HG17168-CM
NSA2/TINP1 cDNA ORF Clone, Human, N-Myc tag HG17168-NM
info info
添加购物车成功! 添加购物车失败!