MTHFD2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52822-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MTHFD2 Reagents
CRO Services
Product recommended

All MTHFD2 Reagents
MTHFD2 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1053 bp
Description
Full length Clone DNA of Mouse methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTHFD2 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AW558851 cDNA ORF Clone, Mouse;NMDMC cDNA ORF Clone, Mouse
MTHFD2 Background Information
Full Name
methylenetetrahydrofolate dehydrogenase 2, methenyltetrahydrofolate cyclohydrolase

MTHFD2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MTHFD2 cDNA ORF Clone in Cloning Vector, Rat RG80539-U
MTHFD2 cDNA ORF Clone, Rat, untagged RG80539-UT
MTHFD2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80539-ACGLN
MTHFD2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80539-ACG
MTHFD2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80539-ANG
MTHFD2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80539-ACR
MTHFD2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80539-ANR
MTHFD2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80539-CF
MTHFD2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80539-NF
MTHFD2 cDNA ORF Clone, Rat, C-His tag RG80539-CH
MTHFD2 cDNA ORF Clone, Rat, N-His tag RG80539-NH
MTHFD2 cDNA ORF Clone, Rat, C-HA tag RG80539-CY
MTHFD2 cDNA ORF Clone, Rat, N-HA tag RG80539-NY
MTHFD2 cDNA ORF Clone, Rat, C-Myc tag RG80539-CM
MTHFD2 cDNA ORF Clone, Rat, N-Myc tag RG80539-NM
MTHFD2 qPCR Primer Pairs, Rat RP300503

MTHFD2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MTHFD2 cDNA ORF Clone in Cloning Vector, Mouse MG52822-G
MTHFD2 cDNA ORF Clone, Mouse, untagged MG52822-UT
MTHFD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52822-ACG
MTHFD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52822-ACGLN
MTHFD2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52822-ANG
MTHFD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52822-ACR
MTHFD2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52822-ANR
MTHFD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52822-CF
MTHFD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52822-NF
MTHFD2 cDNA ORF Clone, Mouse, C-His tag MG52822-CH
MTHFD2 cDNA ORF Clone, Mouse, C-HA tag MG52822-CY
MTHFD2 cDNA ORF Clone, Mouse, N-HA tag MG52822-NY
MTHFD2 cDNA ORF Clone, Mouse, C-Myc tag MG52822-CM
MTHFD2 cDNA ORF Clone, Mouse, N-Myc tag MG52822-NM

MTHFD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTHFD2 cDNA ORF Clone in Cloning Vector, Human HG16324-G
MTHFD2 cDNA ORF Clone, Human, untagged HG16324-UT
MTHFD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16324-ACG
MTHFD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16324-ACGLN
MTHFD2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16324-ANG
MTHFD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16324-ACR
MTHFD2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16324-ANR
MTHFD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16324-CF
MTHFD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16324-NF
MTHFD2 cDNA ORF Clone, Human, C-His tag HG16324-CH
MTHFD2 cDNA ORF Clone, Human, N-His tag HG16324-NH
MTHFD2 cDNA ORF Clone, Human, C-HA tag HG16324-CY
MTHFD2 cDNA ORF Clone, Human, N-HA tag HG16324-NY
MTHFD2 cDNA ORF Clone, Human, C-Myc tag HG16324-CM
MTHFD2 cDNA ORF Clone, Human, N-Myc tag HG16324-NM
MTHFD2 qPCR Primer Pairs, Human HP105077
info info
添加购物车成功! 添加购物车失败!