MRFAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52200-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRFAP1 Reagents
CRO Services
Product recommended

All MRFAP1 Reagents
MRFAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
378 bp
Description
Full length Clone DNA of Mouse Morf4 family associated protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRFAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
9130413I22Rik cDNA ORF Clone, Mouse;AL022827 cDNA ORF Clone, Mouse;Pam14 cDNA ORF Clone, Mouse
MRFAP1 Background Information
Full Name
Morf4 family associated protein 1

MRFAP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRFAP1 cDNA ORF Clone in Cloning Vector, Rat RG85840-U
MRFAP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85840-ACGLN

MRFAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRFAP1 cDNA ORF Clone in Cloning Vector, Mouse MG52200-G
MRFAP1 cDNA ORF Clone, Mouse, untagged MG52200-UT
MRFAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52200-ACG
MRFAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52200-ACGLN
MRFAP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52200-ANG
MRFAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52200-ACR
MRFAP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52200-ANR
MRFAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52200-NF
MRFAP1 cDNA ORF Clone, Mouse, C-His tag MG52200-CH
MRFAP1 cDNA ORF Clone, Mouse, N-His tag MG52200-NH
MRFAP1 cDNA ORF Clone, Mouse, C-HA tag MG52200-CY
MRFAP1 cDNA ORF Clone, Mouse, N-HA tag MG52200-NY
MRFAP1 cDNA ORF Clone, Mouse, C-Myc tag MG52200-CM
MRFAP1 cDNA ORF Clone, Mouse, N-Myc tag MG52200-NM
MRFAP1 qPCR Primer Pairs, Mouse MP202073

MRFAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRFAP1 cDNA ORF Clone in Cloning Vector, Human HG21314-U
MRFAP1 cDNA ORF Clone, Human, untagged HG21314-UT
MRFAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21314-ACGLN
MRFAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG21314-ACG
MRFAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG21314-ANG
MRFAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG21314-ACR
MRFAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG21314-ANR
MRFAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21314-CF
MRFAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21314-NF
MRFAP1 cDNA ORF Clone, Human, C-His tag HG21314-CH
MRFAP1 cDNA ORF Clone, Human, N-His tag HG21314-NH
MRFAP1 cDNA ORF Clone, Human, C-HA tag HG21314-CY
MRFAP1 cDNA ORF Clone, Human, N-HA tag HG21314-NY
MRFAP1 cDNA ORF Clone, Human, C-Myc tag HG21314-CM
MRFAP1 cDNA ORF Clone, Human, N-Myc tag HG21314-NM
info info
添加购物车成功! 添加购物车失败!