MMP-8 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50493-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MMP-8 Reagents

CRO Services

Product recommended


All MMP-8 Reagents

MMP-8 cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Description
Full length Clone DNA of Mouse matrix metallopeptidase 8 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP-8 cDNA ORF Clone, Mouse, C-HA tag Alternative Names

BB138268 cDNA ORF Clone, Mouse

MMP-8 Background Information

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Neutrophil collagenase, also known as Matrix metalloproteinase-8, MMP-8, and CLG1, is a member of the peptidase M10A family. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 in the tumour may have a protective effect against lymph node metastasis. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 participates in wound repair by contributing to the resolution of inflammation and open the possibility to develop new strategies for treating wound healing defects.

Full Name
matrix metallopeptidase 8
References
  • Hasty K.A., et al.,(1990), Human neutrophil collagenase. A distinct gene product with homology to other matrix metalloproteinases. J. Biol. Chem. 265:11421-11424.
  • Blaeser J., et al., (1991), Mercurial activation of human polymorphonuclear leucocyte procollagenase.Eur. J. Biochem. 202:1223-1230.
  • Blaeser J., et al.,(1991), Mercurial activation of human polymorphonuclear leucocyte procollagenase. Eur. J. Biochem. 202:1223-1230.
  • MMP-8 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MMP-8 cDNA ORF Clone in Cloning Vector, Mouse MG50493-M
    MMP-8 cDNA ORF Clone, Mouse, untagged MG50493-UT
    MMP-8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50493-ACG
    MMP-8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50493-ACGLN
    MMP-8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50493-ACR
    MMP-8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50493-CF
    MMP-8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50493-NF
    MMP-8 cDNA ORF Clone, Mouse, C-His tag MG50493-CH
    MMP-8 cDNA ORF Clone, Mouse, N-His tag MG50493-NH
    MMP-8 cDNA ORF Clone, Mouse, N-HA tag MG50493-NY
    MMP-8 cDNA ORF Clone, Mouse, C-Myc tag MG50493-CM
    MMP-8 cDNA ORF Clone, Mouse, N-Myc tag MG50493-NM
    MMP-8 qPCR Primer Pairs, Mouse MP200487

    MMP-8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MMP-8 cDNA ORF Clone in Cloning Vector, Human HG10254-G
    MMP-8 cDNA ORF Clone, Human, untagged HG10254-UT
    MMP-8 cDNA ORF Clone, Human, C-GFPSpark® tag HG10254-ACG
    MMP-8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10254-ACGLN
    MMP-8 cDNA ORF Clone, Human, N-GFPSpark® tag HG10254-ANG
    MMP-8 cDNA ORF Clone, Human, C-OFPSpark® tag HG10254-ACR
    MMP-8 cDNA ORF Clone, Human, N-OFPSpark® tag HG10254-ANR
    MMP-8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10254-CF
    MMP-8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10254-NF
    MMP-8 cDNA ORF Clone, Human, C-His tag HG10254-CH
    MMP-8 cDNA ORF Clone, Human, N-His tag HG10254-NH
    MMP-8 cDNA ORF Clone, Human, C-HA tag HG10254-CY
    MMP-8 cDNA ORF Clone, Human, N-HA tag HG10254-NY
    MMP-8 cDNA ORF Clone, Human, C-Myc tag HG10254-CM
    MMP-8 cDNA ORF Clone, Human, N-Myc tag HG10254-NM
    MMP-8 qPCR Primer Pairs, Human HP100047
    info info
    添加购物车成功! 添加购物车失败!