MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51618-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MFF/mitochondrial fission factor Reagents
CRO Services
Product recommended

All MFF/mitochondrial fission factor Reagents
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
876 bp
Description
Full length Clone DNA of Mouse mitochondrial fission factor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
5230400G24Rik cDNA ORF Clone, Mouse;AI314724 cDNA ORF Clone, Mouse
MFF/mitochondrial fission factor Background Information
Full Name
mitochondrial fission factor

MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MFF/mitochondrial fission factor cDNA ORF Clone in Cloning Vector, Mouse MG51618-G
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, untagged MG51618-UT
MFF/mitochondrial fission factor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51618-ACGLN
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51618-ACG
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51618-ANG
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51618-ACR
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51618-ANR
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51618-CF
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51618-NF
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, C-His tag MG51618-CH
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, N-His tag MG51618-NH
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, C-HA tag MG51618-CY
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, N-HA tag MG51618-NY
MFF/mitochondrial fission factor cDNA ORF Clone, Mouse, N-Myc tag MG51618-NM
MFF/mitochondrial fission factor qPCR Primer Pairs, Mouse MP201491

MFF/mitochondrial fission factor cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MFF/mitochondrial fission factor cDNA ORF Clone, Human, C-GFPSpark® tag HG20870-ACG
MFF/mitochondrial fission factor cDNA ORF Clone, Human, N-GFPSpark® tag HG20870-ANG
MFF/mitochondrial fission factor cDNA ORF Clone, Human, C-OFPSpark® tag HG20870-ACR
MFF/mitochondrial fission factor cDNA ORF Clone, Human, N-OFPSpark® tag HG20870-ANR
info info
添加购物车成功! 添加购物车失败!