LYZ2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52758-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LYZ2 Reagents
CRO Services
Product recommended

All LYZ2 Reagents
LYZ2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
447 bp
Description
Full length Clone DNA of Mouse lysozyme 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LYZ2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AI326280 cDNA ORF Clone, Mouse;Lys cDNA ORF Clone, Mouse;Lysm cDNA ORF Clone, Mouse;Lyzs cDNA ORF Clone, Mouse;Lzm cDNA ORF Clone, Mouse;Lzm-s1 cDNA ORF Clone, Mouse;Lzp cDNA ORF Clone, Mouse
LYZ2 Background Information
Full Name
lysozyme 2

LYZ2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LYZ2 cDNA ORF Clone in Cloning Vector, Rat RG81115-U
LYZ2 cDNA ORF Clone, Rat, untagged RG81115-UT
LYZ2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81115-ACGLN
LYZ2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81115-ACG
LYZ2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81115-ACR
LYZ2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81115-CF
LYZ2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81115-NF
LYZ2 cDNA ORF Clone, Rat, C-His tag RG81115-CH
LYZ2 cDNA ORF Clone, Rat, N-His tag RG81115-NH
LYZ2 cDNA ORF Clone, Rat, C-HA tag RG81115-CY
LYZ2 cDNA ORF Clone, Rat, N-HA tag RG81115-NY
LYZ2 cDNA ORF Clone, Rat, C-Myc tag RG81115-CM
LYZ2 cDNA ORF Clone, Rat, N-Myc tag RG81115-NM
LYZ2 qPCR Primer Pairs, Rat RP301072

LYZ2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LYZ2 cDNA ORF Clone in Cloning Vector, Mouse MG52758-G
LYZ2 cDNA ORF Clone, Mouse, untagged MG52758-UT
LYZ2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52758-ACG
LYZ2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52758-ACGLN
LYZ2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52758-ANG
LYZ2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52758-ACR
LYZ2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52758-ANR
LYZ2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52758-CF
LYZ2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52758-NF
LYZ2 cDNA ORF Clone, Mouse, C-His tag MG52758-CH
LYZ2 cDNA ORF Clone, Mouse, N-His tag MG52758-NH
LYZ2 cDNA ORF Clone, Mouse, C-HA tag MG52758-CY
LYZ2 cDNA ORF Clone, Mouse, N-HA tag MG52758-NY
LYZ2 cDNA ORF Clone, Mouse, N-Myc tag MG52758-NM
info info
添加购物车成功! 添加购物车失败!