LMNA cDNA ORF Clone, Mouse, C-His tag

Cat: MG51713-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LMNA Reagents
CRO Services
Product recommended

All LMNA Reagents
LMNA cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1725 bp
Description
Full length Clone DNA of Mouse lamin A with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LMNA cDNA ORF Clone, Mouse, C-His tag Alternative Names
Dhe cDNA ORF Clone, Mouse
LMNA Background Information
Full Name
lamin A/C

LMNA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LMNA cDNA ORF Clone in Cloning Vector, Mouse MG51713-G
LMNA cDNA ORF Clone, Mouse, untagged MG51713-UT
LMNA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51713-ACGLN
LMNA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51713-ACG
LMNA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51713-ANG
LMNA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51713-ACR
LMNA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51713-ANR
LMNA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51713-CF
LMNA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51713-NF
LMNA cDNA ORF Clone, Mouse, N-His tag MG51713-NH
LMNA cDNA ORF Clone, Mouse, C-HA tag MG51713-CY
LMNA cDNA ORF Clone, Mouse, N-HA tag MG51713-NY
LMNA cDNA ORF Clone, Mouse, C-Myc tag MG51713-CM
LMNA cDNA ORF Clone, Mouse, N-Myc tag MG51713-NM
LMNA qPCR Primer Pairs, Mouse MP201586

LMNA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LMNA cDNA ORF Clone in Cloning Vector, Human HG12058-G
LMNA cDNA ORF Clone, Human, untagged HG12058-UT
LMNA cDNA ORF Clone, Human, C-GFPSpark® tag HG12058-ACG
LMNA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12058-ACGLN
LMNA cDNA ORF Clone, Human, N-GFPSpark® tag HG12058-ANG
LMNA cDNA ORF Clone, Human, C-OFPSpark® tag HG12058-ACR
LMNA cDNA ORF Clone, Human, N-OFPSpark® tag HG12058-ANR
LMNA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12058-CF
LMNA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12058-NF
LMNA cDNA ORF Clone, Human, C-His tag HG12058-CH
LMNA cDNA ORF Clone, Human, N-His tag HG12058-NH
LMNA cDNA ORF Clone, Human, C-HA tag HG12058-CY
LMNA cDNA ORF Clone, Human, N-HA tag HG12058-NY
LMNA cDNA ORF Clone, Human, C-Myc tag HG12058-CM
LMNA cDNA ORF Clone, Human, N-Myc tag HG12058-NM
LMNA qPCR Primer Pairs, Human HP101589
info info
添加购物车成功! 添加购物车失败!