JAGN1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52762-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All JAGN1 Reagents
CRO Services
Product recommended

All JAGN1 Reagents
JAGN1 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
552 bp
Description
Full length Clone DNA of Mouse jagunal homolog 1 (Drosophila) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

JAGN1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
5830427H10Rik cDNA ORF Clone, Mouse
JAGN1 Background Information
Full Name
jagunal homolog 1 (Drosophila)

JAGN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
JAGN1 cDNA ORF Clone in Cloning Vector, Mouse MG52762-G
JAGN1 cDNA ORF Clone, Mouse, untagged MG52762-UT
JAGN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52762-ACG
JAGN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52762-ACGLN
JAGN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52762-ACR
JAGN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52762-CF
JAGN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52762-NF
JAGN1 cDNA ORF Clone, Mouse, C-His tag MG52762-CH
JAGN1 cDNA ORF Clone, Mouse, N-His tag MG52762-NH
JAGN1 cDNA ORF Clone, Mouse, C-HA tag MG52762-CY
JAGN1 cDNA ORF Clone, Mouse, N-HA tag MG52762-NY
JAGN1 cDNA ORF Clone, Mouse, N-Myc tag MG52762-NM

JAGN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
JAGN1 cDNA ORF Clone in Cloning Vector, Human HG27294-U
JAGN1 cDNA ORF Clone, Human, untagged HG27294-UT
JAGN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG27294-ACG
JAGN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG27294-ACGLN
JAGN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG27294-ACR
JAGN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG27294-CF
JAGN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG27294-NF
JAGN1 cDNA ORF Clone, Human, C-His tag HG27294-CH
JAGN1 cDNA ORF Clone, Human, N-His tag HG27294-NH
JAGN1 cDNA ORF Clone, Human, C-HA tag HG27294-CY
JAGN1 cDNA ORF Clone, Human, N-HA tag HG27294-NY
JAGN1 cDNA ORF Clone, Human, C-Myc tag HG27294-CM
JAGN1 cDNA ORF Clone, Human, N-Myc tag HG27294-NM
info info
添加购物车成功! 添加购物车失败!