gp130 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50135-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All gp130 Reagents
CRO Services
Product recommended

All gp130 Reagents
gp130 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2754 bp
Description
Full length Clone DNA of Mouse interleukin 6 signal transducer with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

gp130 cDNA ORF Clone, Mouse, N-His tag Alternative Names
5133400A03Rik cDNA ORF Clone, Mouse;AA389424 cDNA ORF Clone, Mouse;BB405851 cDNA ORF Clone, Mouse;CD130 cDNA ORF Clone, Mouse;D13Ertd699e cDNA ORF Clone, Mouse;gp130 cDNA ORF Clone, Mouse
gp130 Background Information

Glycoprotein 130 (also known as gp130, IL6ST, IL6-beta or CD130) is a transmembrane protein which is the founding member of the class of all cytokine receptors. CD130/gp130 is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and Oncostatin M (OSM). CD130/gp130 functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. CD130/gp130 plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A related pseudogene has been identified on chromosome 17. The receptor systems for IL6, LIF, OSM, CNTF, IL11, CTF1 and BSF3 can utilize gp130 for initiating signal transmission. CD130/gp130 binds to IL6/IL6R (alpha chain) complex, resulting in the formation of high-affinity IL6 binding sites, and transduces the signal. CD130/gp130 may have a role in embryonic development. The type I OSM receptor is capable of transducing OSM-specific signaling events.

Full Name
interleukin 6 signal transducer
References
  • Hibi, et al. (1990) Molecular cloning and expression of an IL-6 signal transducer, gp130. Cell. 63 (6): 1149-57.
  • Kim H, et al. (1997) Transmembrane domain of gp130 contributes to intracellular signal transduction in hepatic cells. J Biol Chem. 272 (49): 30741-7.
  • Giordano V, et al. (1997) Shc mediates IL-6 signaling by interacting with gp130 and Jak2 kinase. J Immunol. 158 (9): 4097-103.
  • gp130 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    gp130 cDNA ORF Clone in Cloning Vector, Rhesus CG90275-G
    gp130 cDNA ORF Clone, Rhesus, untagged CG90275-UT
    gp130 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90275-ACGLN
    gp130 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90275-ACG
    gp130 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90275-ACR
    gp130 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90275-CF
    gp130 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90275-NF
    gp130 cDNA ORF Clone, Rhesus, C-His tag CG90275-CH
    gp130 cDNA ORF Clone, Rhesus, N-His tag CG90275-NH
    gp130 cDNA ORF Clone, Rhesus, C-HA tag CG90275-CY
    gp130 cDNA ORF Clone, Rhesus, N-HA tag CG90275-NY
    gp130 cDNA ORF Clone, Rhesus, C-Myc tag CG90275-CM
    gp130 cDNA ORF Clone, Rhesus, N-Myc tag CG90275-NM

    gp130 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    gp130 cDNA ORF Clone in Cloning Vector, Rat RG80030-M
    gp130 cDNA ORF Clone, Rat, untagged RG80030-UT
    gp130 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80030-ACGLN
    gp130 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80030-ACG
    gp130 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80030-ACR
    gp130 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80030-CF
    gp130 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80030-NF
    gp130 cDNA ORF Clone, Rat, C-His tag RG80030-CH
    gp130 cDNA ORF Clone, Rat, N-His tag RG80030-NH
    gp130 cDNA ORF Clone, Rat, C-HA tag RG80030-CY
    gp130 cDNA ORF Clone, Rat, N-HA tag RG80030-NY
    gp130 cDNA ORF Clone, Rat, C-Myc tag RG80030-CM
    gp130 cDNA ORF Clone, Rat, N-Myc tag RG80030-NM
    gp130 qPCR Primer Pairs, Rat RP300029

    gp130 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    gp130 cDNA ORF Clone in Cloning Vector, Mouse MG50135-M
    gp130 cDNA ORF Clone, Mouse, untagged MG50135-UT
    gp130 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50135-ACG
    gp130 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50135-ACGLN
    gp130 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50135-ACR
    gp130 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50135-CF
    gp130 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50135-NF
    gp130 cDNA ORF Clone, Mouse, C-His tag MG50135-CH
    gp130 cDNA ORF Clone, Mouse, C-HA tag MG50135-CY
    gp130 cDNA ORF Clone, Mouse, N-HA tag MG50135-NY
    gp130 cDNA ORF Clone, Mouse, C-Myc tag MG50135-CM
    gp130 cDNA ORF Clone, Mouse, N-Myc tag MG50135-NM
    gp130 qPCR Primer Pairs, Mouse MP200165

    gp130 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    gp130 cDNA ORF Clone in Cloning Vector, Human HG10974-M
    gp130 cDNA ORF Clone, Human, untagged HG10974-UT
    gp130 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10974-ACGLN
    gp130 cDNA ORF Clone, Human, C-GFPSpark® tag HG10974-ACG
    gp130 cDNA ORF Clone, Human, C-OFPSpark® tag HG10974-ACR
    gp130 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10974-CF
    gp130 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10974-NF
    gp130 cDNA ORF Clone, Human, C-His tag HG10974-CH
    gp130 cDNA ORF Clone, Human, N-His tag HG10974-NH
    gp130 cDNA ORF Clone, Human, C-HA tag HG10974-CY
    gp130 cDNA ORF Clone, Human, N-HA tag HG10974-NY
    gp130 cDNA ORF Clone, Human, C-Myc tag HG10974-CM
    gp130 cDNA ORF Clone, Human, N-Myc tag HG10974-NM
    gp130 qPCR Primer Pairs, Human HP100935
    info info
    添加购物车成功! 添加购物车失败!