IL11 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50117-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL11 Reagents
CRO Services
Product recommended

All IL11 Reagents
IL11 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
600 bp
Description
Full length Clone DNA of Mouse interleukin 11 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL11 cDNA ORF Clone, Mouse, N-His tag Alternative Names
IL-11 cDNA ORF Clone, Mouse
IL11 Background Information

IL11 is a multifunctional cytokine first isolated in 1990 from bone marrow-derived stromal cells. It is a key regulator of multiple events in hematopoiesis, most notably the stimulation of megakaryocyte maturation. IL11 is also known under the names adipogenesis inhibitory factor (AGIF) and oprelvekin. IL11 can improve platelet recovery after chemotherapy-induced thrombocytopenia, induce acute phase proteins, modulate antigen-antibody responses, participate in the regulation of bone cell proliferation and differentiation and could be use as a therapeutic for osteoporosis. IL11 stimulates the growth of certain lymphocytes and, in the murine model, stimulates an increase in the cortical thickness and strength of long bones. As a signaling molecule, IL11 has a variety of functions associated with its receptor interleukin 11 receptor alpha; such functions include placentation and to some extent of decidualization.

Full Name
interleukin 11
References
  • McKinley D. et al., 1992, Genomics. 13 (3): 814-9.
  • Paul SR. et al., 1990, Proc Natl Acad Sci. 87 (19): 7512-6.
  • Kawashima I. et al., 1991, FEBS Lett. 283 (2): 199-202.
  • IL11 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL11 cDNA ORF Clone in Cloning Vector, Rat RG80169-G
    IL11 cDNA ORF Clone, Rat, untagged RG80169-UT
    IL11 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80169-ACGLN
    IL11 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80169-ACG
    IL11 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80169-ACR
    IL11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80169-CF
    IL11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80169-NF
    IL11 cDNA ORF Clone, Rat, C-His tag RG80169-CH
    IL11 cDNA ORF Clone, Rat, N-His tag RG80169-NH
    IL11 cDNA ORF Clone, Rat, C-HA tag RG80169-CY
    IL11 cDNA ORF Clone, Rat, N-HA tag RG80169-NY
    IL11 cDNA ORF Clone, Rat, C-Myc tag RG80169-CM
    IL11 cDNA ORF Clone, Rat, N-Myc tag RG80169-NM
    IL11 qPCR Primer Pairs, Rat RP300162

    IL11 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL11 cDNA ORF Clone in Cloning Vector, Mouse MG50117-M
    IL11 cDNA ORF Clone, Mouse, untagged MG50117-UT
    IL11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50117-ACG
    IL11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50117-ACGLN
    IL11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50117-ACR
    IL11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50117-CF
    IL11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50117-NF
    IL11 cDNA ORF Clone, Mouse, C-His tag MG50117-CH
    IL11 cDNA ORF Clone, Mouse, C-HA tag MG50117-CY
    IL11 cDNA ORF Clone, Mouse, N-HA tag MG50117-NY
    IL11 cDNA ORF Clone, Mouse, C-Myc tag MG50117-CM
    IL11 cDNA ORF Clone, Mouse, N-Myc tag MG50117-NM
    IL11 qPCR Primer Pairs, Mouse MP200147

    IL11 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL11 cDNA ORF Clone in Cloning Vector, Human HG12225-G
    IL11 cDNA ORF Clone, Human, untagged HG12225-UT
    IL11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12225-ACGLN
    IL11 cDNA ORF Clone, Human, C-GFPSpark® tag HG12225-ACG
    IL11 cDNA ORF Clone, Human, C-OFPSpark® tag HG12225-ACR
    IL11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12225-CF
    IL11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12225-NF
    IL11 cDNA ORF Clone, Human, C-His tag HG12225-CH
    IL11 cDNA ORF Clone, Human, N-His tag HG12225-NH
    IL11 cDNA ORF Clone, Human, C-HA tag HG12225-CY
    IL11 cDNA ORF Clone, Human, N-HA tag HG12225-NY
    IL11 cDNA ORF Clone, Human, C-Myc tag HG12225-CM
    IL11 cDNA ORF Clone, Human, N-Myc tag HG12225-NM
    IL11 qPCR Primer Pairs, Human HP101874
    info info
    添加购物车成功! 添加购物车失败!