HID1/C17orf28 cDNA ORF Clone, Mouse, untagged

Cat: MG51388-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HID1/C17orf28 Reagents
CRO Services
Product recommended

All HID1/C17orf28 Reagents
HID1/C17orf28 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2364 bp
Description
Full length Clone DNA of Mouse HID1 domain containing.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HID1/C17orf28 cDNA ORF Clone, Mouse, untagged Alternative Names
C630004H02Rik cDNA ORF Clone, Mouse
HID1/C17orf28 Background Information
Full Name
HID1 domain containing

HID1/C17orf28 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HID1/C17orf28 cDNA ORF Clone in Cloning Vector, Mouse MG51388-U
HID1/C17orf28 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51388-ACGLN
HID1/C17orf28 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51388-ACG
HID1/C17orf28 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51388-ANG
HID1/C17orf28 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51388-ACR
HID1/C17orf28 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51388-ANR
HID1/C17orf28 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51388-CF
HID1/C17orf28 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51388-NF
HID1/C17orf28 cDNA ORF Clone, Mouse, C-His tag MG51388-CH
HID1/C17orf28 cDNA ORF Clone, Mouse, N-His tag MG51388-NH
HID1/C17orf28 cDNA ORF Clone, Mouse, C-HA tag MG51388-CY
HID1/C17orf28 cDNA ORF Clone, Mouse, N-HA tag MG51388-NY
HID1/C17orf28 cDNA ORF Clone, Mouse, C-Myc tag MG51388-CM
HID1/C17orf28 cDNA ORF Clone, Mouse, N-Myc tag MG51388-NM
HID1/C17orf28 qPCR Primer Pairs, Mouse MP201261

HID1/C17orf28 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HID1/C17orf28 cDNA ORF Clone in Cloning Vector, Human HG14963-G
HID1/C17orf28 cDNA ORF Clone, Human, untagged HG14963-UT
HID1/C17orf28 cDNA ORF Clone, Human, C-GFPSpark® tag HG14963-ACG
HID1/C17orf28 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14963-ACGLN
HID1/C17orf28 cDNA ORF Clone, Human, N-GFPSpark® tag HG14963-ANG
HID1/C17orf28 cDNA ORF Clone, Human, C-OFPSpark® tag HG14963-ACR
HID1/C17orf28 cDNA ORF Clone, Human, N-OFPSpark® tag HG14963-ANR
HID1/C17orf28 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14963-CF
HID1/C17orf28 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14963-NF
HID1/C17orf28 cDNA ORF Clone, Human, C-His tag HG14963-CH
HID1/C17orf28 cDNA ORF Clone, Human, N-His tag HG14963-NH
HID1/C17orf28 cDNA ORF Clone, Human, C-HA tag HG14963-CY
HID1/C17orf28 cDNA ORF Clone, Human, N-HA tag HG14963-NY
HID1/C17orf28 cDNA ORF Clone, Human, C-Myc tag HG14963-CM
HID1/C17orf28 cDNA ORF Clone, Human, N-Myc tag HG14963-NM
HID1/C17orf28 qPCR Primer Pairs, Human HP103592
info info
添加购物车成功! 添加购物车失败!