HHIP cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50380-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HHIP Reagents
CRO Services
Product recommended

All HHIP Reagents
HHIP cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2103 bp
Description
Full length Clone DNA of Mouse Hedgehog-interacting protein with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HHIP cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
Hhip1 cDNA ORF Clone, Mouse
HHIP Background Information
Full Name
hedgehog interacting protein

HHIP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HHIP cDNA ORF Clone in Cloning Vector, Mouse MG50380-M
HHIP cDNA ORF Clone, Mouse, untagged MG50380-UT
HHIP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50380-ACGLN
HHIP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50380-ACG
HHIP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50380-ACR
HHIP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50380-CF
HHIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50380-NF
HHIP cDNA ORF Clone, Mouse, C-His tag MG50380-CH
HHIP cDNA ORF Clone, Mouse, N-His tag MG50380-NH
HHIP cDNA ORF Clone, Mouse, C-HA tag MG50380-CY
HHIP cDNA ORF Clone, Mouse, N-HA tag MG50380-NY
HHIP cDNA ORF Clone, Mouse, N-Myc tag MG50380-NM
HHIP qPCR Primer Pairs, Mouse MP200400

HHIP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HHIP cDNA ORF Clone in Cloning Vector, Human HG13798-G
HHIP cDNA ORF Clone, Human, untagged HG13798-UT
HHIP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13798-ACGLN
HHIP cDNA ORF Clone, Human, C-GFPSpark® tag HG13798-ACG
HHIP cDNA ORF Clone, Human, C-OFPSpark® tag HG13798-ACR
HHIP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13798-CF
HHIP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13798-NF
HHIP cDNA ORF Clone, Human, C-His tag HG13798-CH
HHIP cDNA ORF Clone, Human, N-His tag HG13798-NH
HHIP cDNA ORF Clone, Human, C-HA tag HG13798-CY
HHIP cDNA ORF Clone, Human, N-HA tag HG13798-NY
HHIP cDNA ORF Clone, Human, C-Myc tag HG13798-CM
HHIP cDNA ORF Clone, Human, N-Myc tag HG13798-NM
HHIP qPCR Primer Pairs, Human HP102471
info info
添加购物车成功! 添加购物车失败!