Gremlin 2/GREM2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50123-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Gremlin 2/GREM2 Reagents
CRO Services
Product recommended

All Gremlin 2/GREM2 Reagents
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
507 bp
Description
Full length Clone DNA of Mouse gremlin 2 homolog, cysteine knot superfamily (Xenopus laevis) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Gremlin 2/GREM2 cDNA ORF Clone, Mouse, N-His tag Alternative Names
Gremlin2 cDNA ORF Clone, Mouse;Prdc cDNA ORF Clone, Mouse
Gremlin 2/GREM2 Background Information
Full Name
gremlin 2, DAN family BMP antagonist

Gremlin 2/GREM2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Gremlin 2/GREM2 cDNA ORF Clone in Cloning Vector, Mouse MG50123-M
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, untagged MG50123-UT
Gremlin 2/GREM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50123-ACGLN
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50123-ACG
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50123-ACR
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50123-CF
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50123-NF
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, C-His tag MG50123-CH
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, C-HA tag MG50123-CY
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, N-HA tag MG50123-NY
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, C-Myc tag MG50123-CM
Gremlin 2/GREM2 cDNA ORF Clone, Mouse, N-Myc tag MG50123-NM
Gremlin 2/GREM2 qPCR Primer Pairs, Mouse MP200153

Gremlin 2/GREM2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Gremlin 2/GREM2 cDNA ORF Clone in Cloning Vector, Human HG10283-U
Gremlin 2/GREM2 cDNA ORF Clone, Human, untagged HG10283-UT
Gremlin 2/GREM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10283-ACGLN
Gremlin 2/GREM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10283-ACG
Gremlin 2/GREM2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10283-ACR
Gremlin 2/GREM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10283-CF
Gremlin 2/GREM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10283-NF
Gremlin 2/GREM2 cDNA ORF Clone, Human, C-His tag HG10283-CH
Gremlin 2/GREM2 cDNA ORF Clone, Human, N-His tag HG10283-NH
Gremlin 2/GREM2 cDNA ORF Clone, Human, C-HA tag HG10283-CY
Gremlin 2/GREM2 cDNA ORF Clone, Human, N-HA tag HG10283-NY
Gremlin 2/GREM2 cDNA ORF Clone, Human, C-Myc tag HG10283-CM
Gremlin 2/GREM2 cDNA ORF Clone, Human, N-Myc tag HG10283-NM
Gremlin 2/GREM2 qPCR Primer Pairs, Human HP104857
info info
添加购物车成功! 添加购物车失败!