CD42c cDNA ORF Clone, Mouse, C-His tag

Cat: MG51075-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD42c Reagents
CRO Services
Product recommended

All CD42c Reagents
CD42c cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
645 bp
Description
Full length Clone DNA of Mouse glycoprotein Ib, beta polypeptide with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD42c Background Information

Platelet glycoprotein Ib (GPIb) complex is best known as a major platelet receptor for von Willebrand factor essential for platelet adhesion under high shear conditions found in arteries and in thrombosis. The GPIb complex is composed of GPIb alpha (Platelet glycoprotein Ib alpha chain) covalently attached to GPIb beta (Platelet glycoprotein Ib beta chain) and noncovalently complexed with GPIX and GPV. GPIb-beta, also known as GP1BB, CD42b-beta and CD42c, is single-pass type I membrane protein expressed in heart and brain, which is a critical component of the von Willebrand factor (vWF) receptor. The cysteine knot region of GPIb beta in the N terminus is critical for the conformation of GPIb beta that interacts with GPIX. The precursor of GP1BB is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. GPIb is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. GPIb alpha chain provides the vWF binding site, and GPIb beta chain contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. GP1BB is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (vWF), and mediates platelet adhesion in the arterial circulation. Defects in GP1BB are a cause of Bernard-Soulier syndrome (BSS), also known as giant platelet disease (GPD). BSS patients have unusually large platelets and have a clinical bleeding tendency.

Full Name
glycoprotein Ib (platelet), beta polypeptide
References
  • Kenny D, et al. (2002) The cysteine knot of platelet glycoprotein Ib beta (GPIb beta) is critical for the interaction of GPIb beta with GPIX. Blood. 99(12): 4428-33.
  • Tang J,et al. (2004) Mutation in the leucine-rich repeat C-flanking region of platelet glycoprotein Ib beta impairs assembly of von Willebrand factor receptor. Thromb Haemost. 92(1): 75-88.
  • Vanhoorelbeke K, et al. (2007) Inhibition of platelet glycoprotein Ib and its antithrombotic potential. Curr Pharm Des. 13(26): 2684-97.
  • Clemetson KJ, et al. (2008) Platelet GPIb complex as a target for anti-thrombotic drug development. Thromb Haemost. 99(3): 473-9.
  • CD42c cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD42c cDNA ORF Clone in Cloning Vector, Rat RG80428-G
    CD42c cDNA ORF Clone, Rat, untagged RG80428-UT
    CD42c cDNA ORF Clone, Rat, C-GFPSpark® tag RG80428-ACG
    CD42c Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80428-ACGLN
    CD42c cDNA ORF Clone, Rat, C-OFPSpark® tag RG80428-ACR
    CD42c cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80428-CF
    CD42c cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80428-NF
    CD42c cDNA ORF Clone, Rat, C-His tag RG80428-CH
    CD42c cDNA ORF Clone, Rat, N-His tag RG80428-NH
    CD42c cDNA ORF Clone, Rat, C-HA tag RG80428-CY
    CD42c cDNA ORF Clone, Rat, N-HA tag RG80428-NY
    CD42c cDNA ORF Clone, Rat, C-Myc tag RG80428-CM
    CD42c cDNA ORF Clone, Rat, N-Myc tag RG80428-NM
    CD42c qPCR Primer Pairs, Rat RP300401

    CD42c cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD42c cDNA ORF Clone in Cloning Vector, Mouse MG51075-G
    CD42c cDNA ORF Clone, Mouse, untagged MG51075-UT
    CD42c Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51075-ACGLN
    CD42c cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51075-ACG
    CD42c cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51075-ACR
    CD42c cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51075-CF
    CD42c cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51075-NF
    CD42c cDNA ORF Clone, Mouse, N-His tag MG51075-NH
    CD42c cDNA ORF Clone, Mouse, C-HA tag MG51075-CY
    CD42c cDNA ORF Clone, Mouse, N-HA tag MG51075-NY
    CD42c cDNA ORF Clone, Mouse, C-Myc tag MG51075-CM
    CD42c cDNA ORF Clone, Mouse, N-Myc tag MG51075-NM
    CD42c qPCR Primer Pairs, Mouse MP201033

    CD42c cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD42c cDNA ORF Clone in Cloning Vector, Human HG10742-U
    CD42c cDNA ORF Clone, Human, untagged HG10742-UT
    CD42c cDNA ORF Clone, Human, C-GFPSpark® tag HG10742-ACG
    CD42c Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10742-ACGLN
    CD42c cDNA ORF Clone, Human, C-OFPSpark® tag HG10742-ACR
    CD42c cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10742-CF
    CD42c cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10742-NF
    CD42c cDNA ORF Clone, Human, C-His tag HG10742-CH
    CD42c cDNA ORF Clone, Human, N-His tag HG10742-NH
    CD42c cDNA ORF Clone, Human, C-HA tag HG10742-CY
    CD42c cDNA ORF Clone, Human, N-HA tag HG10742-NY
    CD42c cDNA ORF Clone, Human, C-Myc tag HG10742-CM
    CD42c cDNA ORF Clone, Human, N-Myc tag HG10742-NM
    CD42c qPCR Primer Pairs, Human HP100675
    info info
    添加购物车成功! 添加购物车失败!