FAM195B cDNA ORF Clone, Mouse, untagged

Cat: MG52453-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAM195B Reagents
CRO Services
Product recommended

All FAM195B Reagents
FAM195B cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
294 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 195, member B.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM195B Background Information
Full Name
family with sequence similarity 195 member B

FAM195B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FAM195B cDNA ORF Clone in Cloning Vector, Rat RG81164-U
FAM195B cDNA ORF Clone, Rat, untagged RG81164-UT
FAM195B cDNA ORF Clone, Rat, C-GFPSpark® tag RG81164-ACG
FAM195B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81164-ACGLN
FAM195B cDNA ORF Clone, Rat, N-GFPSpark® tag RG81164-ANG
FAM195B cDNA ORF Clone, Rat, C-OFPSpark® tag RG81164-ACR
FAM195B cDNA ORF Clone, Rat, N-OFPSpark® tag RG81164-ANR
FAM195B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81164-CF
FAM195B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81164-NF
FAM195B cDNA ORF Clone, Rat, C-His tag RG81164-CH
FAM195B cDNA ORF Clone, Rat, N-His tag RG81164-NH
FAM195B cDNA ORF Clone, Rat, C-HA tag RG81164-CY
FAM195B cDNA ORF Clone, Rat, N-HA tag RG81164-NY
FAM195B cDNA ORF Clone, Rat, C-Myc tag RG81164-CM
FAM195B cDNA ORF Clone, Rat, N-Myc tag RG81164-NM
FAM195B qPCR Primer Pairs, Rat RP301120

FAM195B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM195B cDNA ORF Clone in Cloning Vector, Mouse MG52453-G
FAM195B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52453-ACGLN
FAM195B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52453-ACG
FAM195B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52453-ANG
FAM195B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52453-ACR
FAM195B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52453-ANR
FAM195B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52453-CF
FAM195B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52453-NF
FAM195B cDNA ORF Clone, Mouse, C-His tag MG52453-CH
FAM195B cDNA ORF Clone, Mouse, N-His tag MG52453-NH
FAM195B cDNA ORF Clone, Mouse, C-HA tag MG52453-CY
FAM195B cDNA ORF Clone, Mouse, N-HA tag MG52453-NY
FAM195B cDNA ORF Clone, Mouse, C-Myc tag MG52453-CM
FAM195B cDNA ORF Clone, Mouse, N-Myc tag MG52453-NM
FAM195B qPCR Primer Pairs, Mouse MP202326

FAM195B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM195B cDNA ORF Clone in Cloning Vector, Human HG16304-G
FAM195B cDNA ORF Clone, Human, untagged HG16304-UT
FAM195B cDNA ORF Clone, Human, C-GFPSpark® tag HG16304-ACG
FAM195B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16304-ACGLN
FAM195B cDNA ORF Clone, Human, N-GFPSpark® tag HG16304-ANG
FAM195B cDNA ORF Clone, Human, C-OFPSpark® tag HG16304-ACR
FAM195B cDNA ORF Clone, Human, N-OFPSpark® tag HG16304-ANR
FAM195B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16304-CF
FAM195B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16304-NF
FAM195B cDNA ORF Clone, Human, C-His tag HG16304-CH
FAM195B cDNA ORF Clone, Human, N-His tag HG16304-NH
FAM195B cDNA ORF Clone, Human, C-HA tag HG16304-CY
FAM195B cDNA ORF Clone, Human, N-HA tag HG16304-NY
FAM195B cDNA ORF Clone, Human, C-Myc tag HG16304-CM
FAM195B cDNA ORF Clone, Human, N-Myc tag HG16304-NM
FAM195B qPCR Primer Pairs, Human HP105058
info info
添加购物车成功! 添加购物车失败!