FAM131A cDNA ORF Clone, Mouse, N-HA tag

Cat: MG51990-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FAM131A Reagents

CRO Services

Product recommended


All FAM131A Reagents

FAM131A cDNA ORF Clone, Mouse, N-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1086 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 131, member A with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM131A cDNA ORF Clone, Mouse, N-HA tag Alternative Names

2900046G09Rik cDNA ORF Clone, Mouse

FAM131A Background Information

Full Name
family with sequence similarity 131, member A

FAM131A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM131A cDNA ORF Clone in Cloning Vector, Mouse MG51990-U
FAM131A cDNA ORF Clone, Mouse, untagged MG51990-UT
FAM131A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51990-ACGLN
FAM131A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51990-ACG
FAM131A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51990-ACR
FAM131A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51990-CF
FAM131A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51990-NF
FAM131A cDNA ORF Clone, Mouse, C-His tag MG51990-CH
FAM131A cDNA ORF Clone, Mouse, N-His tag MG51990-NH
FAM131A cDNA ORF Clone, Mouse, C-HA tag MG51990-CY
FAM131A cDNA ORF Clone, Mouse, C-Myc tag MG51990-CM
FAM131A cDNA ORF Clone, Mouse, N-Myc tag MG51990-NM
FAM131A qPCR Primer Pairs, Mouse MP201863

FAM131A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM131A cDNA ORF Clone in Cloning Vector, Human HG13477-G
FAM131A cDNA ORF Clone, Human, untagged HG13477-UT
FAM131A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13477-ACGLN
FAM131A cDNA ORF Clone, Human, C-GFPSpark® tag HG13477-ACG
FAM131A cDNA ORF Clone, Human, C-OFPSpark® tag HG13477-ACR
FAM131A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13477-CF
FAM131A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13477-NF
FAM131A cDNA ORF Clone, Human, C-His tag HG13477-CH
FAM131A cDNA ORF Clone, Human, N-His tag HG13477-NH
FAM131A cDNA ORF Clone, Human, C-HA tag HG13477-CY
FAM131A cDNA ORF Clone, Human, N-HA tag HG13477-NY
FAM131A cDNA ORF Clone, Human, C-Myc tag HG13477-CM
FAM131A cDNA ORF Clone, Human, N-Myc tag HG13477-NM
FAM131A qPCR Primer Pairs, Human HP102177
info info
添加购物车成功! 添加购物车失败!