ENTPD3 cDNA ORF Clone, Mouse, untagged

Cat: MG50269-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ENTPD3 Reagents
CRO Services
Product recommended

All ENTPD3 Reagents
ENTPD3 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1590 bp
Description
Full length Clone DNA of Mouse ectonucleoside triphosphate diphosphohydrolase 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ENTPD3 cDNA ORF Clone, Mouse, untagged Alternative Names
Cd39l3 cDNA ORF Clone, Mouse;HB6 cDNA ORF Clone, Mouse;NTPDase-3 cDNA ORF Clone, Mouse
ENTPD3 Background Information
Full Name
ectonucleoside triphosphate diphosphohydrolase 3
References
  • Fausther M, et al. (2010) Cystic fibrosis remodels the regulation of purinergic signaling by NTPDase1 (CD39) and NTPDase3. Am J Physiol Lung Cell Mol Physiol. 298(6): 804-18.
  • Vlajkovic SM, et al. (2006) Noise-induced up-regulation of NTPDase3 expression in the rat cochlea: Implications for auditory transmission and cochlear protection. Brain Res. 1104(1): 55-63.
  • Ivanenkov w, et al. (2005) Characterization of disulfide bonds in human nucleoside triphosphate diphosphohydrolase 3 (NTPDase3): implications for NTPDase structural modeling. Biochemistry. 44 (25): 8998-9012.
  • ENTPD3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ENTPD3 cDNA ORF Clone in Cloning Vector, Mouse MG50269-M
    ENTPD3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50269-ACG
    ENTPD3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50269-ACGLN
    ENTPD3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50269-ACR
    ENTPD3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50269-CF
    ENTPD3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50269-NF
    ENTPD3 cDNA ORF Clone, Mouse, C-His tag MG50269-CH
    ENTPD3 cDNA ORF Clone, Mouse, N-His tag MG50269-NH
    ENTPD3 cDNA ORF Clone, Mouse, C-HA tag MG50269-CY
    ENTPD3 cDNA ORF Clone, Mouse, N-HA tag MG50269-NY
    ENTPD3 cDNA ORF Clone, Mouse, C-Myc tag MG50269-CM
    ENTPD3 cDNA ORF Clone, Mouse, N-Myc tag MG50269-NM
    ENTPD3 qPCR Primer Pairs, Mouse MP200294

    ENTPD3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ENTPD3 cDNA ORF Clone in Cloning Vector, Human HG10909-M
    ENTPD3 cDNA ORF Clone, Human, untagged HG10909-UT
    ENTPD3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10909-ACGLN
    ENTPD3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10909-ACG
    ENTPD3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10909-ACR
    ENTPD3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10909-CF
    ENTPD3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10909-NF
    ENTPD3 cDNA ORF Clone, Human, C-His tag HG10909-CH
    ENTPD3 cDNA ORF Clone, Human, N-His tag HG10909-NH
    ENTPD3 cDNA ORF Clone, Human, C-HA tag HG10909-CY
    ENTPD3 cDNA ORF Clone, Human, N-HA tag HG10909-NY
    ENTPD3 cDNA ORF Clone, Human, C-Myc tag HG10909-CM
    ENTPD3 cDNA ORF Clone, Human, N-Myc tag HG10909-NM
    ENTPD3 qPCR Primer Pairs, Human HP100931
    info info
    添加购物车成功! 添加购物车失败!