EMC4/TMEM85 cDNA ORF Clone, Mouse, untagged

Cat: MG51379-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EMC4/TMEM85 Reagents
CRO Services
Product recommended

All EMC4/TMEM85 Reagents
EMC4/TMEM85 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
552 bp
Description
Full length Clone DNA of Mouse ER membrane protein complex subunit 4.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EMC4/TMEM85 cDNA ORF Clone, Mouse, untagged Alternative Names
2610318K02Rik cDNA ORF Clone, Mouse;Tmem85 cDNA ORF Clone, Mouse
EMC4/TMEM85 Background Information
Full Name
ER membrane protein complex subunit 4

EMC4/TMEM85 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EMC4/TMEM85 cDNA ORF Clone in Cloning Vector, Mouse MG51379-U
EMC4/TMEM85 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51379-ACG
EMC4/TMEM85 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51379-ACGLN
EMC4/TMEM85 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51379-ANG
EMC4/TMEM85 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51379-ACR
EMC4/TMEM85 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51379-ANR
EMC4/TMEM85 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51379-CF
EMC4/TMEM85 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51379-NF
EMC4/TMEM85 cDNA ORF Clone, Mouse, C-His tag MG51379-CH
EMC4/TMEM85 cDNA ORF Clone, Mouse, N-His tag MG51379-NH
EMC4/TMEM85 cDNA ORF Clone, Mouse, C-HA tag MG51379-CY
EMC4/TMEM85 cDNA ORF Clone, Mouse, N-HA tag MG51379-NY
EMC4/TMEM85 cDNA ORF Clone, Mouse, C-Myc tag MG51379-CM
EMC4/TMEM85 cDNA ORF Clone, Mouse, N-Myc tag MG51379-NM
EMC4/TMEM85 qPCR Primer Pairs, Mouse MP201252

EMC4/TMEM85 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EMC4/TMEM85 cDNA ORF Clone in Cloning Vector, Human HG17207-U
EMC4/TMEM85 cDNA ORF Clone, Human, untagged HG17207-UT
EMC4/TMEM85 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17207-ACGLN
EMC4/TMEM85 cDNA ORF Clone, Human, C-GFPSpark® tag HG17207-ACG
EMC4/TMEM85 cDNA ORF Clone, Human, C-OFPSpark® tag HG17207-ACR
EMC4/TMEM85 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17207-CF
EMC4/TMEM85 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17207-NF
EMC4/TMEM85 cDNA ORF Clone, Human, C-His tag HG17207-CH
EMC4/TMEM85 cDNA ORF Clone, Human, N-His tag HG17207-NH
EMC4/TMEM85 cDNA ORF Clone, Human, C-HA tag HG17207-CY
EMC4/TMEM85 cDNA ORF Clone, Human, N-HA tag HG17207-NY
EMC4/TMEM85 cDNA ORF Clone, Human, C-Myc tag HG17207-CM
EMC4/TMEM85 cDNA ORF Clone, Human, N-Myc tag HG17207-NM
info info
添加购物车成功! 添加购物车失败!