Neutrophil Elastase cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50204-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Neutrophil Elastase Reagents
CRO Services
Product recommended

All Neutrophil Elastase Reagents
Neutrophil Elastase cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
798 bp
Description
Full length Clone DNA of Mouse elastase, neutrophil expressed with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About Neutrophil Elastase
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Neutrophil Elastase cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Ela2 cDNA ORF Clone, Mouse;F430011M15Rik cDNA ORF Clone, Mouse;NE cDNA ORF Clone, Mouse
Neutrophil Elastase Background Information

Neutrophil elastase, also known as Elastase-2, Bone marrow serine protease, Medullasin, ELANE, and ELA2, is a serine proteinase in the same family as chymotrypsin and has broad substrate specificity. Secreted by neutrophils during inflammation, it destroys bacteria and host tissue. As with other serine proteinases, ELANE / ELA2 contains a charge relay system composed of the catalytic triad of histidine, aspartate, and serine residues that are dispersed throughout the primary sequence of the polypeptide but that are brought together in the three dimension conformation of the folded protein. ELANE / ELA2 is an important protease enzyme that when expressed aberrantly can cause emphysema or emphysematous changes. This involves breakdown of the lung structure and increased airspaces. Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. ELANE / ELA2 hydrolyzes proteins within specialized neutrophil lysosomes, called azurophil granules, as well as proteins of the extracellular matrix following the protein's release from activated neutrophils. ELANE / ELA2 may play a role in degenerative and inflammatory diseases by its proteolysis of collagen-IV and elastin of the extracellular matrix. ELANE / ELA2 degrades the outer membrane protein A (OmpA) of E. coli as well as the virulence factors of such bacteria as Shigella, Salmonella and Yersinia. Defects in ELANE are a cause of cyclic haematopoiesis (CH), also known as cyclic neutropenia. CH is an autosomal dominant disease in which blood-cell production from the bone marrow oscillates with 21-day periodicity. Defects in ELANE are also the cause of autosomal dominant severe congenital neutropenia type 1 (SCN1) which is a heterogeneous disorder of hematopoiesis.

Full Name
elastase, neutrophil expressed
References
  • Nakamura H., et al.,(1987), Nucleotide sequence of human bone marrow serine protease (medullasin) gene. Nucleic Acids Res. 15:9601-9601.
  • Takahashi H., et al., (1988), Structure of the human neutrophil elastase gene.J. Biol. Chem. 263:14739-14747.
  • Farley D., et al.,(1989), The human neutrophil elastase gene. Analysis of the nucleotide sequence reveals three distinct classes of repetitive DNA.Biol. Chem. Hoppe-Seyler 370:737-744.
  • info info
    添加购物车成功! 添加购物车失败!